ID: 1039866768

View in Genome Browser
Species Human (GRCh38)
Location 8:41511776-41511798
Sequence CAACATCCATGGGCTCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039866764_1039866768 -1 Left 1039866764 8:41511754-41511776 CCATGCGCCAGTCTGTGGAGAGC 0: 8
1: 18
2: 13
3: 23
4: 120
Right 1039866768 8:41511776-41511798 CAACATCCATGGGCTCTGCAAGG No data
1039866765_1039866768 -8 Left 1039866765 8:41511761-41511783 CCAGTCTGTGGAGAGCAACATCC No data
Right 1039866768 8:41511776-41511798 CAACATCCATGGGCTCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039866768 Original CRISPR CAACATCCATGGGCTCTGCA AGG Intergenic
No off target data available for this crispr