ID: 1039869131

View in Genome Browser
Species Human (GRCh38)
Location 8:41530397-41530419
Sequence GCTTACTTTAGAACAGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039869131 Original CRISPR GCTTACTTTAGAACAGGGAC TGG Intronic
908225610 1:62053090-62053112 GCTTACTTGGGAACTGGGAGTGG - Intronic
909803535 1:79845806-79845828 GCTTACTTTTAAAGAGGGCCTGG + Intergenic
910423682 1:87098712-87098734 CATTTCTTTAGAACAGGGATTGG + Intronic
910568624 1:88675517-88675539 TCTTCCTACAGAACAGGGACAGG - Intergenic
912561387 1:110554207-110554229 GGTTACTTTAAAACAGATACAGG - Intergenic
912677225 1:111694459-111694481 GGTAACTTTAAAACAGGGTCTGG - Intronic
916522582 1:165578242-165578264 CCTGACTTCAGAACAGGGAAAGG + Intergenic
917452908 1:175162015-175162037 GCTGAGTTCAGAACAGGAACAGG - Intronic
920687332 1:208119384-208119406 GTTTGCTTTGGATCAGGGACAGG - Intronic
921018118 1:211211165-211211187 GTTTACTTAAGAACTGGGCCAGG + Intergenic
921593480 1:217029955-217029977 CCTCCCTTTAGCACAGGGACAGG + Intronic
922490770 1:226014680-226014702 TCTTCCTTTAGAACAGAGACTGG + Intergenic
923287830 1:232514090-232514112 CCTTACTTTAGAAATGAGACTGG - Exonic
1062851035 10:743598-743620 AGTTCCTTTAGAACAGGAACCGG - Intergenic
1067022865 10:42817017-42817039 TATTTCTTTAGAACAGGGTCTGG + Intronic
1070599223 10:77854105-77854127 GCTTGCTCTTGCACAGGGACAGG + Intronic
1071178655 10:82957316-82957338 GCTTATTGTATCACAGGGACTGG - Intronic
1071206894 10:83290387-83290409 TCTTTCTTTAGATCAAGGACAGG - Intergenic
1075200659 10:120401045-120401067 GCTTCCTTTAGAAATGGAACTGG + Intergenic
1075933316 10:126318118-126318140 GCTGACTTTAGGACAGGTACAGG + Intronic
1079039578 11:17049772-17049794 GATTACTTGAGATCAGGGATTGG + Intergenic
1080006884 11:27417998-27418020 GCTTCCTTTACAAGAGGGAAAGG + Intronic
1092302564 12:7265943-7265965 GCTGACTTCAGAACTGTGACAGG + Intergenic
1093643006 12:21550165-21550187 GCTGATTTTAGAACTGTGACAGG - Intronic
1094620402 12:32075311-32075333 CCTTACTCTAGAACAGGGAAAGG - Intergenic
1095686331 12:45039613-45039635 GCTTACTATATATCAGGCACTGG + Intronic
1096614155 12:52822253-52822275 GCATGCTTTAGGACAGGTACAGG + Intronic
1097731789 12:63136785-63136807 ACATACTTTAGAACAGGAATTGG - Intergenic
1100707198 12:97213840-97213862 GAGTACTTTAGAACAGTGCCTGG - Intergenic
1100845595 12:98655000-98655022 GATTACTTGAGATCAGGGATTGG + Intronic
1102866337 12:116378040-116378062 GCTTACTTTGGAAGATCGACGGG + Intergenic
1104387029 12:128359601-128359623 TCTGATTTTAGAACAGGGTCAGG - Intronic
1105209843 13:18251209-18251231 GCTTACTTGAGATTAGGGAGTGG - Intergenic
1105556261 13:21449041-21449063 GATTACTTGAGATCAGGGATTGG - Intronic
1108051287 13:46441512-46441534 GCTTACTTTAAAAGAGTGCCTGG - Intergenic
1108058353 13:46507747-46507769 GTTAACTTTAGAACAGGAATTGG + Intergenic
1109086619 13:57981102-57981124 GTTTGCTTTAGAACAGGGTATGG - Intergenic
1109543842 13:63815132-63815154 GCTTACTTTAAAAGAGTGCCTGG - Intergenic
1118594545 14:67425642-67425664 CCTTCCTTTCGAAAAGGGACTGG + Intergenic
1122475463 14:102005391-102005413 GATTACCTTTCAACAGGGACAGG - Intronic
1123424021 15:20154195-20154217 TATTTCTTTAGAACAGGGTCTGG + Intergenic
1123533242 15:21160724-21160746 TATTTCTTTAGAACAGGGTCTGG + Intergenic
1126783256 15:52156304-52156326 GCTGATTTTAGAGCAAGGACAGG - Intronic
1127273440 15:57421732-57421754 GCATACTGAAGAGCAGGGACGGG - Intronic
1130824283 15:87527903-87527925 ACTTACTGTAAAACAGGGTCTGG + Intergenic
1135538975 16:23315499-23315521 ACTTACTATAGAACAGGCATGGG + Intronic
1140528166 16:75641252-75641274 GTTTACTTTAGACCAGGGGCTGG - Intronic
1141352676 16:83312665-83312687 GCTGATGTTAGAAGAGGGACAGG + Intronic
1141545841 16:84767949-84767971 GATTACTTGAGATCAGGGATTGG + Intronic
1144441725 17:15288885-15288907 GCATATTCTAGAACAAGGACAGG + Intergenic
1147365534 17:39956649-39956671 GCTCACTGCAGAACAGCGACAGG + Intergenic
1148036191 17:44662158-44662180 GCTTGCTTTATACCAGGGATTGG - Intronic
1149604389 17:57914593-57914615 GCTCGATTTAGAAAAGGGACAGG + Intronic
1152901176 17:82941891-82941913 TGTTACTTTAGAAGAGTGACGGG - Intronic
1155114989 18:22755224-22755246 CCTTACTTTAGATCAGTGACTGG - Intergenic
1156479825 18:37429124-37429146 GCTTACTTTATAACAGGGGCTGG + Intronic
1158323336 18:56287638-56287660 GCTTGCTTTTGAGCAGAGACCGG - Intergenic
1159914796 18:74179135-74179157 GGTTACTTTAGAGCAAGGGCTGG - Intergenic
1160320697 18:77891377-77891399 ACCTCCTTGAGAACAGGGACTGG + Intergenic
1160888133 19:1361849-1361871 GCTGACTATAGAACAGGGTAGGG - Intronic
1162351343 19:10151603-10151625 GTTTTCTTCATAACAGGGACAGG + Intronic
1163505270 19:17702060-17702082 GCTGACCTGATAACAGGGACTGG - Intergenic
1165397300 19:35571568-35571590 GCTTCCTGGAGAACAGGGATGGG - Intergenic
1166341361 19:42139351-42139373 GCGAATTTCAGAACAGGGACTGG - Intronic
926142430 2:10375681-10375703 CCTCACTGTACAACAGGGACAGG + Intronic
928875854 2:36038494-36038516 GCTAACTCTAGAGCAGGGCCAGG - Intergenic
929585685 2:43112818-43112840 AGTTCCTTTAGAAGAGGGACAGG + Intergenic
930084642 2:47487071-47487093 GTTTATTTCAGACCAGGGACTGG - Intronic
932321404 2:70824537-70824559 GCTGACTCTAGAACTGGGGCAGG + Intergenic
933970002 2:87462634-87462656 GCTGAAATTAAAACAGGGACAGG - Intergenic
934459227 2:94202847-94202869 TATTTCTTTAGAACAGGGTCTGG - Intergenic
935917029 2:107965738-107965760 CCTTACTCTACAACAGGGGCAGG + Intergenic
936323779 2:111487862-111487884 GCTGAAATTAAAACAGGGACAGG + Intergenic
940087033 2:149871782-149871804 GCTTACTTCAAGACAGGCACTGG - Intergenic
942630906 2:177947590-177947612 GATTACTTGAGATCAGGGATTGG - Intronic
942845358 2:180417905-180417927 GCTAACTATAGTACAGGCACTGG - Intergenic
943613919 2:190069307-190069329 ACTTACTTTAGAACAAACACAGG + Intronic
946007528 2:216538368-216538390 GCAGACTTTAAAACAGGTACAGG - Intronic
1168795470 20:608081-608103 GGATGCTTTAGAACAGGGGCAGG - Intronic
1170112496 20:12821241-12821263 ACCTACTTTAGGACAGGTACCGG + Intergenic
1171290999 20:23982896-23982918 GCTTACTTGAGATTAGGGAGTGG - Intergenic
1172742539 20:37180009-37180031 GCTTAGTTTAGAACAGTGCATGG + Intronic
1173877328 20:46382293-46382315 GCTTACATTCAAACAAGGACCGG + Intronic
1174190049 20:48734184-48734206 CCTTACTTTAGACCAGGAATGGG + Intronic
1177720132 21:24895276-24895298 GTTTACTTTAGAAAGGTGACTGG + Intergenic
1179625806 21:42649089-42649111 GCTTGCTGTAGACCAGGCACTGG - Intergenic
1180766417 22:18348191-18348213 GCTTACTTGAGATTAGGGAGTGG + Intergenic
1180779898 22:18514187-18514209 GCTTACTTGAGATTAGGGAGTGG - Intergenic
1180812612 22:18771508-18771530 GCTTACTTGAGATTAGGGAGTGG - Intergenic
1181198771 22:21205756-21205778 GCTTACTTGAGATTAGGGAGTGG - Intergenic
1181356982 22:22303642-22303664 TATTTCTTTAGAACAGGGTCTGG + Intergenic
1181400966 22:22650043-22650065 GCTTACTTGAGATTAGGGAGTGG + Intergenic
1181534856 22:23536316-23536338 GCTTACTTGAGATTAGGGAGTGG - Intergenic
1181702945 22:24631135-24631157 GCTTACTTGAGATTAGGGAGTGG + Intergenic
1203228034 22_KI270731v1_random:89081-89103 GCTTACTTGAGATTAGGGAGTGG + Intergenic
949819195 3:8097104-8097126 TCTCACTTTAATACAGGGACAGG + Intergenic
954780113 3:53052522-53052544 GCTTACCACAGAACAGGCACTGG + Intronic
955178334 3:56640315-56640337 TGTTAATTTAGAACAGGGATTGG + Intronic
955650769 3:61191663-61191685 GATTAGTTTAAAACAGGGAAAGG + Intronic
955743505 3:62117622-62117644 GCTTACTGTGGAAGAGGCACTGG + Intronic
956575966 3:70753103-70753125 GCTTGCTTTAGAAGAGGAAGAGG + Intergenic
956914127 3:73852816-73852838 GCTTATTTAAGAACAGGAAGAGG - Intergenic
958946409 3:100367312-100367334 GCCTACTGTAGAGCAGGGAGAGG + Intronic
960352614 3:116611661-116611683 GCTTGCTTTAGGGCAGGGGCTGG - Intronic
964510953 3:157450894-157450916 GCTTACTATATACCAGGTACTGG - Intronic
968948153 4:3676332-3676354 GCTTTCTTTACACCAGGGCCAGG + Intergenic
969210860 4:5685920-5685942 GCTTAGGTGAGAACAGTGACTGG - Intronic
974121317 4:57642386-57642408 GTTTACTTTAGATGAGGGACTGG + Intergenic
974128433 4:57723866-57723888 GCTTTCTTCAGTACAGGCACTGG + Intergenic
975451333 4:74530406-74530428 GCTTACTTCAGAAAAGTCACAGG - Intergenic
975672931 4:76799955-76799977 GCTTACTTCAGAATTGAGACAGG + Intergenic
976418898 4:84814651-84814673 GGTTACTTGAACACAGGGACTGG - Intronic
978131760 4:105206576-105206598 ACTGACTTTAAAAGAGGGACTGG + Intronic
984367298 4:178815853-178815875 CCTTATTCTAGAACAGGGACTGG - Intergenic
985269490 4:188180337-188180359 CATTGCTTTGGAACAGGGACAGG + Intergenic
987042235 5:14073775-14073797 GGTGACTTTGGATCAGGGACAGG + Intergenic
987644830 5:20655753-20655775 GCTTCCTTTAGAAGAGAGAGAGG + Intergenic
994592286 5:101788607-101788629 GCTTGCTTTAGCAGAGAGACTGG + Intergenic
995622348 5:114039944-114039966 GCTTGCTCTAGATCAGGGAAAGG - Intergenic
997127384 5:131241359-131241381 GCTTACTTTAGAATAATGCCCGG - Intergenic
1004256198 6:14067069-14067091 GCTTGCTTTAGGACAGGGCTGGG - Intergenic
1004767766 6:18750307-18750329 GCTTACCTGAGAACAGAGGCAGG - Intergenic
1005315817 6:24601868-24601890 GCTTATTGTAGACAAGGGACTGG + Intronic
1007673993 6:43580080-43580102 GATTACTTGAGATCAGGGATTGG + Intronic
1010498163 6:76561522-76561544 GCTTACTTTAGAGAAGAGAGTGG - Intergenic
1011183745 6:84651274-84651296 GTTTCCTTGAGAACTGGGACTGG + Intergenic
1014396619 6:120931707-120931729 GCGTACTTGAGATTAGGGACTGG - Intergenic
1015177863 6:130330524-130330546 GGTTAGTTTAGAATAGGGAAAGG + Intronic
1017311016 6:152977828-152977850 GCTGTCTTTAGAACAGTTACTGG + Intronic
1019496450 7:1342588-1342610 GCTTCCTGTAGAACATGGGCAGG - Intergenic
1026945010 7:74310215-74310237 TTTTATTTTAGAACAGAGACAGG - Intronic
1027371477 7:77510402-77510424 GATTACTTGAGATCAGGGATTGG - Intergenic
1028433086 7:90770880-90770902 GCCTACTTAAGAAGAGGGCCTGG - Intronic
1028660743 7:93270302-93270324 GCTTACCTTAGAAGAATGACTGG - Intronic
1030838697 7:114320703-114320725 GGTAACTTAAGAACAGAGACTGG - Intronic
1033480253 7:141733173-141733195 GTATACTTTAAAACAAGGACAGG - Intergenic
1034910058 7:154988690-154988712 GCTGAGTTTGGGACAGGGACAGG - Intronic
1036286499 8:7448043-7448065 TCTTATTTGGGAACAGGGACAGG - Intronic
1036334978 8:7863485-7863507 TCTTATTTGGGAACAGGGACAGG + Exonic
1039429922 8:37517721-37517743 GCTGTCTTAAGAAGAGGGACAGG + Intergenic
1039739736 8:40371411-40371433 GTTTACTTTATGACAGGCACTGG + Intergenic
1039869131 8:41530397-41530419 GCTTACTTTAGAACAGGGACTGG + Intronic
1043321378 8:78990924-78990946 TCTTACTTGAGAACAGAGAATGG - Intergenic
1047781836 8:128117986-128118008 GATTACTTGAGATCAGGGATTGG + Intergenic
1049344703 8:142132592-142132614 GCTGGCTTTAGCACTGGGACAGG + Intergenic
1052042481 9:23754887-23754909 GCTTACTTCTGAACTGGTACAGG - Intronic
1053689722 9:40578634-40578656 TATTTCTTTAGAACAGGGTCTGG - Intergenic
1054300970 9:63379573-63379595 TATTTCTTTAGAACAGGGTCTGG - Intergenic
1055070876 9:72164432-72164454 GCTTATTTCAGCACAGGGAGAGG + Intronic
1056511426 9:87309790-87309812 GGTTATTTGAGGACAGGGACAGG - Intergenic
1058824429 9:108762082-108762104 GCTTCCTTTAGACCAGGCTCTGG + Intergenic
1060053835 9:120396476-120396498 GCTGACTTTAGAACAAGGAATGG - Intronic
1060607564 9:124930173-124930195 ACTTACGTTAGAGAAGGGACAGG - Intronic
1061033429 9:128100461-128100483 GCTTCCCTGAGAGCAGGGACTGG + Intronic
1187311999 X:18153881-18153903 GCTTTCTTTAGTTCAGAGACTGG + Intergenic
1188676905 X:32952448-32952470 GCTTACTTTAGAGCAGTCACAGG + Intronic
1189403114 X:40690889-40690911 TCATGCTTTAGAACAGGGATTGG - Intronic
1189846613 X:45144569-45144591 ACTGACTTTTGAAGAGGGACTGG + Intergenic
1193324632 X:80165382-80165404 ACTTATTTTAGGACAGAGACGGG + Intergenic
1199084185 X:143609814-143609836 GCTTAATTTAAAACTGGGCCAGG - Intergenic
1200017140 X:153174877-153174899 GCTTAGTTTAGCACTGGGGCAGG + Intergenic
1201398823 Y:13580349-13580371 GGTTACTTTGTAACTGGGACTGG + Intergenic