ID: 1039870252

View in Genome Browser
Species Human (GRCh38)
Location 8:41539969-41539991
Sequence GTCCACCTTCTGTAAGTTAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039870252_1039870257 -9 Left 1039870252 8:41539969-41539991 CCCCTAACTTACAGAAGGTGGAC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1039870257 8:41539983-41540005 AAGGTGGACCTCTTTCGGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 83
1039870252_1039870261 18 Left 1039870252 8:41539969-41539991 CCCCTAACTTACAGAAGGTGGAC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1039870261 8:41540010-41540032 CAGGACGTTCTCCCTGCAGGTGG 0: 1
1: 0
2: 1
3: 11
4: 157
1039870252_1039870260 15 Left 1039870252 8:41539969-41539991 CCCCTAACTTACAGAAGGTGGAC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1039870260 8:41540007-41540029 AAACAGGACGTTCTCCCTGCAGG 0: 1
1: 0
2: 2
3: 12
4: 85
1039870252_1039870259 -1 Left 1039870252 8:41539969-41539991 CCCCTAACTTACAGAAGGTGGAC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1039870259 8:41539991-41540013 CCTCTTTCGGGCAGGTAAACAGG 0: 1
1: 0
2: 0
3: 1
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039870252 Original CRISPR GTCCACCTTCTGTAAGTTAG GGG (reversed) Exonic
900097325 1:945250-945272 CTCCACCTGCTGGAAGTCAGCGG - Intronic
905051045 1:35051436-35051458 TTTCACCTTCTGTAAGTTTTCGG + Intergenic
907944202 1:59118648-59118670 ATTCACCTTTTGTATGTTAGTGG + Intergenic
911686941 1:100788169-100788191 GTTCAGCTTCTGCAAGTCAGAGG - Intergenic
916372307 1:164112333-164112355 GTCCATCATCTGCAAGTGAGTGG - Intergenic
918151885 1:181803978-181804000 CTCCGCATGCTGTAAGTTAGGGG + Intronic
920082312 1:203383806-203383828 GTCCATGTTCTGGAAGATAGAGG + Intergenic
920876028 1:209836829-209836851 TTCCAACTTCTGAAACTTAGAGG - Exonic
1066095639 10:32069513-32069535 TTCCACCTTCTCTAAGTGATAGG + Intergenic
1070369973 10:75772942-75772964 GTACACCTTCTGAAAGTGAATGG + Intronic
1073223561 10:101896764-101896786 CTCCAGCTTCTGTAATTTATAGG - Intronic
1076367682 10:129932737-129932759 GTGCACCTTCTGTAACTTCGTGG - Intronic
1077712583 11:4551709-4551731 TTCCCCCTTCTCTAAGTGAGAGG + Intergenic
1079816676 11:25068861-25068883 GTAAACATTCTGTAAGTGAGGGG - Intronic
1084197391 11:67531353-67531375 GTTCACTTTCTGTAAGTTGCTGG - Intergenic
1089183685 11:116600083-116600105 GTCCCAGTTCTGTAACTTAGAGG - Intergenic
1091002940 11:131925860-131925882 TTCCACCTTTTGTAATTCAGGGG + Intronic
1091852119 12:3708110-3708132 GTCCACCTTCTAAGAGTTACAGG - Intronic
1091897249 12:4115572-4115594 GCCCACATTCTGTAAGGCAGTGG - Intergenic
1092712041 12:11349189-11349211 TTCCATCTTCTGTAATTTAGTGG + Intergenic
1095447522 12:42296860-42296882 ATCCACCTTCTGGAACTTACTGG - Intronic
1099459847 12:82909018-82909040 GTCCACCTTCACAAAGTTTGGGG - Intronic
1100847432 12:98674473-98674495 ATCTAGCTTCAGTAAGTTAGGGG - Intronic
1106285182 13:28312474-28312496 GTCCTACTTCTGTAAGTGTGGGG - Intronic
1107202835 13:37742418-37742440 GAGCACCTTCTGTATGTCAGGGG + Intronic
1107959701 13:45546965-45546987 TTCCTCCTTCTCTAAGTAAGAGG + Intronic
1116275962 14:42831509-42831531 GATCACCTTCTGTAAATTATAGG + Intergenic
1124041586 15:26110640-26110662 GTCCACCATCTGTAGGGGAGTGG + Intergenic
1124808661 15:32911684-32911706 GGCCACCTTCTCAAACTTAGGGG + Intronic
1127557190 15:60099220-60099242 GTCCACCTTCTGTAAGCCCCAGG - Intergenic
1129122550 15:73409735-73409757 TTCTACCTTCTCTTAGTTAGAGG + Intergenic
1134106201 16:11487254-11487276 TTCAACCTTCTGGAGGTTAGAGG - Exonic
1134880746 16:17743665-17743687 GTCCACCTTCTGCCTGTTGGGGG - Intergenic
1142351712 16:89583683-89583705 GGCCACAATCTGTAAGTCAGAGG - Exonic
1143343622 17:6233278-6233300 GGCCACCATCTCTAAGTTAATGG + Intergenic
1151101965 17:71566191-71566213 ATTCACCTACTGTAAATTAGCGG + Intergenic
1152320496 17:79606359-79606381 ATCCACCATCTTTAATTTAGGGG - Intergenic
1159362717 18:67426269-67426291 GTCATCCTTCTGTCAGTTATTGG + Intergenic
1159593008 18:70355153-70355175 TTCCACTTTCTGTCATTTAGTGG - Intergenic
1164289301 19:23852936-23852958 ATCCAGCTTCTGTAACTCAGCGG + Intergenic
1168258105 19:55178221-55178243 GTCCACCTTCAGGAAGTGAAGGG - Exonic
941472368 2:165903770-165903792 CTCCACATTATGTAACTTAGGGG - Intronic
942477429 2:176342698-176342720 GTCCATTTTCTCTAAGTTATTGG + Intergenic
942484892 2:176428595-176428617 GTCAACCTTCTGTTCCTTAGGGG + Intergenic
944143524 2:196482268-196482290 CTCCCCCTTCTGCAAGTTATTGG + Intronic
944354085 2:198764546-198764568 GGGCACCTTCTGTAAGTTTCAGG - Intergenic
946297797 2:218799513-218799535 CCCCTCCTTCTGTAAGTTTGGGG + Intronic
946571471 2:221028597-221028619 CTCTACCTTCTGTTAGATAGTGG - Intergenic
947889440 2:233604072-233604094 GTGCACCTTCTTCAAGATAGTGG - Intergenic
947890875 2:233618229-233618251 GTGCACCTTCTTCAAGATAGTGG - Exonic
947895977 2:233672456-233672478 GTGCACCTTCTTCAAGATAGTGG - Exonic
947896859 2:233682459-233682481 GTGCACCTTCTTCAAGATAGTGG - Exonic
1173773450 20:45683786-45683808 GTCATCCTACTGTGAGTTAGTGG - Intergenic
1181974573 22:26719886-26719908 GTCTACCTTCTGGAAGTTAATGG - Intergenic
1182964009 22:34504636-34504658 GTCCACCTGCTGTACCATAGAGG + Intergenic
952073012 3:29661862-29661884 ATCCACCTTCACTAAGTTGGGGG - Intronic
953961313 3:47268208-47268230 GGCCTCCTCCTGTAAATTAGAGG - Intronic
954718094 3:52536896-52536918 GGAGACCTTCTGTAAGTGAGGGG + Exonic
954996887 3:54889934-54889956 GTCCACCATCTGTAACTGATTGG + Intronic
961712299 3:128836946-128836968 GTCCTCCTTTTTTAAGTTGGAGG + Intergenic
965735663 3:171817728-171817750 GTCCCCACTCTGTAAGCTAGAGG + Intergenic
979451001 4:120870893-120870915 GACCACCTACTATATGTTAGAGG + Intronic
980207026 4:129733123-129733145 GTACACATTCTGTATATTAGGGG - Intergenic
982402930 4:154988316-154988338 ATCCAGCTTTTGGAAGTTAGAGG - Intergenic
986606025 5:9523818-9523840 GTACACCATCTGTAAGGGAGCGG - Intronic
989414424 5:41156950-41156972 GTCCAACCTCTGTAAGTGACAGG - Intronic
1029484459 7:100830933-100830955 ACCCACGTTCTGTAATTTAGTGG - Intronic
1031805597 7:126303149-126303171 GTCCACCTGCTGTACTGTAGAGG + Intergenic
1032851227 7:135797329-135797351 TTCCACTTTCAGTAGGTTAGGGG + Intergenic
1039870252 8:41539969-41539991 GTCCACCTTCTGTAAGTTAGGGG - Exonic
1041890664 8:62864673-62864695 GTCCTGCTTCTGTCAGTAAGTGG - Intronic
1043406297 8:79937538-79937560 TTCAACCTTCTGAAAATTAGAGG - Intronic
1047771833 8:128036162-128036184 GTTCACCTTTTGTTAGTTAAGGG + Intergenic
1059549017 9:115208789-115208811 TTCCATCTTCATTAAGTTAGTGG + Intronic
1059694219 9:116715549-116715571 GTCCACCCTCAGTAGGTTAGGGG + Intronic
1194025347 X:88744839-88744861 TTCCACCTTCTGTTGGTTTGGGG - Intergenic
1197379625 X:125723496-125723518 GTTCTCTTTCTGTAAATTAGGGG - Intergenic
1202019244 Y:20448179-20448201 CTCCACCTTTTCTAAGTGAGAGG + Intergenic