ID: 1039873646

View in Genome Browser
Species Human (GRCh38)
Location 8:41567510-41567532
Sequence CTGCGGGGCACCGTGAGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039873636_1039873646 6 Left 1039873636 8:41567481-41567503 CCTGCAGCTGTGTGCCCTGTAGG No data
Right 1039873646 8:41567510-41567532 CTGCGGGGCACCGTGAGCGCAGG No data
1039873642_1039873646 -8 Left 1039873642 8:41567495-41567517 CCCTGTAGGGGCTTCCTGCGGGG No data
Right 1039873646 8:41567510-41567532 CTGCGGGGCACCGTGAGCGCAGG No data
1039873644_1039873646 -9 Left 1039873644 8:41567496-41567518 CCTGTAGGGGCTTCCTGCGGGGC No data
Right 1039873646 8:41567510-41567532 CTGCGGGGCACCGTGAGCGCAGG No data
1039873634_1039873646 26 Left 1039873634 8:41567461-41567483 CCCGCACTCTCGGGGGCGAGCCT No data
Right 1039873646 8:41567510-41567532 CTGCGGGGCACCGTGAGCGCAGG No data
1039873635_1039873646 25 Left 1039873635 8:41567462-41567484 CCGCACTCTCGGGGGCGAGCCTG No data
Right 1039873646 8:41567510-41567532 CTGCGGGGCACCGTGAGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039873646 Original CRISPR CTGCGGGGCACCGTGAGCGC AGG Intergenic
No off target data available for this crispr