ID: 1039873998

View in Genome Browser
Species Human (GRCh38)
Location 8:41569944-41569966
Sequence TTGATCATGAATAGGGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039873990_1039873998 6 Left 1039873990 8:41569915-41569937 CCTTCTAGAAGGCCTGACTCCAT No data
Right 1039873998 8:41569944-41569966 TTGATCATGAATAGGGCAGGTGG No data
1039873993_1039873998 -6 Left 1039873993 8:41569927-41569949 CCTGACTCCATTAAGGGTTGATC No data
Right 1039873998 8:41569944-41569966 TTGATCATGAATAGGGCAGGTGG No data
1039873987_1039873998 13 Left 1039873987 8:41569908-41569930 CCCCTTGCCTTCTAGAAGGCCTG No data
Right 1039873998 8:41569944-41569966 TTGATCATGAATAGGGCAGGTGG No data
1039873986_1039873998 14 Left 1039873986 8:41569907-41569929 CCCCCTTGCCTTCTAGAAGGCCT No data
Right 1039873998 8:41569944-41569966 TTGATCATGAATAGGGCAGGTGG No data
1039873988_1039873998 12 Left 1039873988 8:41569909-41569931 CCCTTGCCTTCTAGAAGGCCTGA No data
Right 1039873998 8:41569944-41569966 TTGATCATGAATAGGGCAGGTGG No data
1039873989_1039873998 11 Left 1039873989 8:41569910-41569932 CCTTGCCTTCTAGAAGGCCTGAC No data
Right 1039873998 8:41569944-41569966 TTGATCATGAATAGGGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039873998 Original CRISPR TTGATCATGAATAGGGCAGG TGG Intergenic
No off target data available for this crispr