ID: 1039878077

View in Genome Browser
Species Human (GRCh38)
Location 8:41604521-41604543
Sequence TACCATCACCACTGTGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 130}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039878077_1039878083 0 Left 1039878077 8:41604521-41604543 CCCCCTCCACAGTGGTGATGGTA 0: 1
1: 0
2: 1
3: 17
4: 130
Right 1039878083 8:41604544-41604566 TTACTAGGAGTAGAATTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039878077 Original CRISPR TACCATCACCACTGTGGAGG GGG (reversed) Intronic
901633107 1:10657390-10657412 CACCATGACGACTGTGGAGAAGG + Intronic
903807803 1:26017798-26017820 TACCTTCATCCCTGTGGAGGAGG - Intergenic
904301705 1:29558420-29558442 TCCCAACACCAGAGTGGAGGAGG + Intergenic
908380551 1:63593614-63593636 TATCATCTCCACCGTGGAGCCGG + Intronic
909871398 1:80743764-80743786 TACCATCCCCACCCTGGATGAGG + Intergenic
910466263 1:87503417-87503439 TAATATCTCCACTGTGGTGGTGG + Intergenic
915290882 1:154882439-154882461 TGCCAGCACCAGTGTTGAGGGGG - Intergenic
915368740 1:155330478-155330500 TGTCATCACCACAGTGGATGAGG + Exonic
916428180 1:164701619-164701641 GACCATCACCACAGGGGAGTGGG - Intronic
916729492 1:167553504-167553526 CACCATCTCCACGCTGGAGGCGG - Exonic
918482817 1:184997878-184997900 TACCGTACCCACTGTGCAGGAGG + Intergenic
921203616 1:212829421-212829443 AACCATCACCACTGTGGGGATGG + Intergenic
921963529 1:221062626-221062648 TGACATCACCCCAGTGGAGGTGG - Intergenic
922478364 1:225922203-225922225 CACCATCAGCTCTGTGGAGAAGG - Exonic
922863921 1:228842566-228842588 TACCATCACCCCTATAGAGAGGG - Intergenic
923788142 1:237087759-237087781 TCCAAGCCCCACTGTGGAGGGGG - Intronic
1064873761 10:19969410-19969432 TTCCATCTCCATTGGGGAGGGGG - Intronic
1065821478 10:29529718-29529740 GCCCATCACCACTGAAGAGGTGG - Exonic
1069181180 10:65360951-65360973 CACCGTCACCACTGTGGGGTTGG + Intergenic
1071221619 10:83473826-83473848 TGCCATCCCCTCAGTGGAGGTGG + Intergenic
1071458056 10:85866366-85866388 TATCATCATTACTGTGGAGGTGG - Intronic
1072419509 10:95278029-95278051 TGCCATTATCACTGAGGAGGAGG - Intronic
1075891369 10:125954070-125954092 TCCTATCTCCACTGTGGAGTTGG + Intronic
1076340423 10:129741628-129741650 TACCATTACCACTGTGTTCGAGG + Intronic
1076449493 10:130546958-130546980 CACCATCACCACAGTGGGAGTGG + Intergenic
1076553894 10:131309237-131309259 CACCAGCTCCACTGTGGAAGAGG + Exonic
1077350818 11:2092473-2092495 TTCCAGCACCACTGTGCAAGCGG + Intergenic
1078120605 11:8504990-8505012 TGCCATCACTGCTGTGGAGTTGG - Intronic
1081189767 11:40088941-40088963 TACCATGAATATTGTGGAGGGGG + Intergenic
1087066867 11:94035706-94035728 TTTCATGACCACTCTGGAGGGGG - Intronic
1089083343 11:115796126-115796148 CACCAGCATCACTGTGGTGGTGG - Intergenic
1089172359 11:116522010-116522032 TATCATAACCACTGGGGAGGGGG + Intergenic
1093108876 12:15124605-15124627 AACAATCACAACTGTGTAGGAGG - Intronic
1093463621 12:19428369-19428391 TACCATCACCACATTGGAGAAGG - Intronic
1102726466 12:115069857-115069879 TATCACCTCCACTGTGCAGGTGG - Intergenic
1103230978 12:119330211-119330233 TCCCATGACCACTGTGAAGGTGG - Intergenic
1103631601 12:122266151-122266173 TACCTGCACCCCTGTGCAGGAGG - Intronic
1106861350 13:33912306-33912328 TACCACCATCACTGTGGGGTGGG - Intronic
1108092071 13:46859485-46859507 TATAATCTCCAATGTGGAGGTGG + Intronic
1110486596 13:76051833-76051855 TCCCCTCACCACTGTAGAGAAGG + Intergenic
1111946489 13:94670763-94670785 GAGCCTCACCACTTTGGAGGGGG - Intergenic
1116970433 14:51059115-51059137 TCCCAGGACCATTGTGGAGGTGG - Intronic
1120143594 14:80955525-80955547 TGACCTCACCACTGTGGAGGAGG - Exonic
1120986490 14:90340006-90340028 TACTACCAGCACTGCGGAGGTGG + Intergenic
1121139507 14:91528805-91528827 TACCCTAACCACTGTGGCTGGGG + Intergenic
1122662588 14:103307754-103307776 TACCATCATCACTGTTTTGGGGG - Intergenic
1123033365 14:105461530-105461552 AACCATCAGCCCTGGGGAGGTGG + Intronic
1124160315 15:27262321-27262343 TACCATCAGCAATGTGGAGAGGG - Intronic
1128244099 15:66121152-66121174 ATCCATCACCACTGAGGTGGTGG - Intronic
1130259139 15:82341849-82341871 TCCCATCATGACTGTGGATGTGG - Intronic
1130269533 15:82437265-82437287 TCCCATCATGACTGTGGATGTGG + Intronic
1130282127 15:82527300-82527322 TCCCATCATGACTGTGGATGTGG + Intergenic
1130473496 15:84243495-84243517 TCCCATCATGACTGTGGATGTGG + Exonic
1130480910 15:84357559-84357581 TCCCATCATGACTGTGGATGTGG + Intergenic
1130490802 15:84430200-84430222 TCCCATCATGACTGTGGATGTGG - Intergenic
1130502389 15:84508968-84508990 TCCCATCATGACTGTGGATGTGG - Intergenic
1130595775 15:85248101-85248123 TCCCATCATGACTGTGGATGTGG + Intergenic
1136105746 16:28029090-28029112 TACCTTGACCACAGTGGAGAAGG - Intronic
1138392305 16:56678981-56679003 TGCCATCACCCCTGCAGAGGCGG - Intronic
1143659083 17:8313644-8313666 TCCCCTCACCTTTGTGGAGGTGG - Intronic
1147315040 17:39616012-39616034 TAGCATCACCACTATGGTGTGGG - Intergenic
1147758083 17:42781277-42781299 CACCGACACCACAGTGGAGGTGG + Exonic
1149524631 17:57345212-57345234 AACCATAACCACAGTGCAGGTGG - Intronic
1157761103 18:50266336-50266358 CACGATCACCACTTTGGGGGTGG + Exonic
1159777282 18:72618446-72618468 CACATGCACCACTGTGGAGGAGG + Intronic
1160192163 18:76723305-76723327 AACCCTCATCACTGTGGTGGTGG + Intergenic
1160681738 19:414680-414702 TAAAATCACAACTGTGGAGTGGG - Intergenic
1164785992 19:30931446-30931468 AGCCATCACTTCTGTGGAGGAGG + Intergenic
1166010202 19:39935818-39935840 TTCCAGCACCACTGAGGAGCAGG - Intergenic
1167111119 19:47461970-47461992 TGCCATCATCACTAGGGAGGGGG + Intronic
1167577295 19:50323926-50323948 GAACATCACCAACGTGGAGGTGG - Exonic
1167660347 19:50792454-50792476 TGCCATCCCCACTGTGCAGATGG - Intronic
1168386143 19:55964785-55964807 TGCCATCACCACAACGGAGGTGG - Intronic
929984294 2:46711687-46711709 TATCTTCACAACTGTGGGGGTGG - Intronic
930986436 2:57593893-57593915 TACCAACACTACAGTGGTGGTGG + Intergenic
932837291 2:75049566-75049588 CACCATCTCCACAGTGGTGGGGG - Exonic
932978726 2:76636172-76636194 TACCATCACAACTGGGGATTAGG + Intergenic
937621247 2:123990114-123990136 AACCATCACAATTGTGGAGGTGG + Intergenic
938103122 2:128511901-128511923 TGCAATCCCCACGGTGGAGGTGG - Intergenic
938191404 2:129284854-129284876 TAACATCTCGACTGTGGTGGTGG - Intergenic
940051254 2:149467339-149467361 TAGCATCACCACTGGGAAAGTGG + Intronic
944912158 2:204321666-204321688 TACTACCAGCAGTGTGGAGGAGG + Intergenic
947264686 2:228265576-228265598 CATCTTCACGACTGTGGAGGGGG - Intergenic
947920044 2:233862479-233862501 CACCCTCACCAATGTGGGGGGGG - Intergenic
1169288470 20:4328944-4328966 GACCATCAACCCTGTGGGGGAGG - Intergenic
1173361346 20:42347137-42347159 TACCATCTCCATTTTGGAGCAGG - Intronic
1173691313 20:44963298-44963320 TGTCATTACCACTGTGGAGGGGG - Intergenic
1174375180 20:50121842-50121864 TAGCCTCACCACTGTGGTGTTGG - Intronic
1175215477 20:57389992-57390014 TCCCATCCCCACTGTGCAGAGGG + Intergenic
1175560777 20:59927739-59927761 TTACATCACCACTGAGGAGCTGG + Intronic
1175921127 20:62451064-62451086 CCCCATGACCACTGTGGTGGGGG + Intergenic
1176254426 20:64143564-64143586 CACCATGACCTGTGTGGAGGTGG - Intergenic
1178342020 21:31793805-31793827 TACCTTTCCCACTGTGGAGTAGG + Intergenic
1178842153 21:36146395-36146417 CAGCATCAGGACTGTGGAGGAGG + Exonic
1178932519 21:36832010-36832032 TTCCATCACCACGGTGGAAGGGG + Intronic
1181594052 22:23902942-23902964 GACCCTCACAACTGTGGTGGAGG + Intergenic
1182255791 22:29037333-29037355 TCCCATCACCACTTTGTGGGTGG - Intronic
1184380385 22:44141657-44141679 AACCATCACGCCTGTGGAGAGGG + Intronic
949135055 3:554508-554530 TGCCTTCACAACTGTGCAGGTGG - Intergenic
953420816 3:42751856-42751878 TACCTACACACCTGTGGAGGAGG + Intronic
953430538 3:42836194-42836216 TCTCATCACAACTTTGGAGGTGG - Intronic
960165082 3:114392133-114392155 TGTCAACACCACTGGGGAGGAGG + Intronic
962195784 3:133362342-133362364 GGACATCATCACTGTGGAGGAGG - Intronic
963330245 3:143905797-143905819 TTGCACCACCACTGTGGAGCAGG - Intergenic
964017949 3:151970900-151970922 CATCAGCACCACTGTAGAGGGGG - Intergenic
966432452 3:179846488-179846510 AACCATCACAGCTGGGGAGGTGG - Intronic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
971227879 4:24771649-24771671 CACCAATGCCACTGTGGAGGAGG + Intergenic
976530851 4:86150540-86150562 TCACATTACCCCTGTGGAGGAGG - Intronic
977666573 4:99651580-99651602 TCTGATCACCGCTGTGGAGGTGG + Exonic
981316120 4:143341419-143341441 TACCACCATCGCTCTGGAGGAGG + Intronic
983900536 4:173128680-173128702 TACCATCACCTTTCTAGAGGAGG - Intergenic
987265330 5:16247395-16247417 TTCCATCATCCCTGGGGAGGTGG - Intergenic
989204034 5:38793850-38793872 GACCATCAGCAGTGTGCAGGAGG - Intergenic
990005375 5:50938940-50938962 TACCATAGCCACTGTGGGTGTGG - Intergenic
990285438 5:54296885-54296907 CACCACCACCACTGTGGCAGAGG + Intronic
991139033 5:63217289-63217311 TAACATCACAACTGTAGAGGTGG - Intergenic
995744698 5:115391557-115391579 TCCCATCACCAGGGTGGAGGAGG - Intergenic
995754485 5:115488096-115488118 TTTCATCACCATTATGGAGGTGG - Intergenic
996625349 5:125564039-125564061 TACAATCAACACAGGGGAGGTGG + Intergenic
998524450 5:142829543-142829565 TCACATCACCATTGTGGAGAGGG + Intronic
998836112 5:146203961-146203983 TACTATCACCATTGTGGTGGGGG + Intronic
1000320277 5:160129179-160129201 CACAGGCACCACTGTGGAGGGGG + Intergenic
1003477731 6:6499619-6499641 TAAAAACAGCACTGTGGAGGTGG + Intergenic
1018183572 6:161245290-161245312 TCCCATCACCCCTGTGGGGCCGG - Intronic
1018277087 6:162144628-162144650 TAGCTTCACCACTGCAGAGGGGG + Intronic
1018766416 6:166936715-166936737 TTTGATCACCAGTGTGGAGGTGG - Intronic
1019786192 7:2979070-2979092 TTCCGTCACCACTGTGGTGGGGG - Intronic
1027522237 7:79223830-79223852 TACCAACAGCCCTGTGAAGGAGG - Intronic
1031982483 7:128136632-128136654 TGTCATCACCACAGAGGAGGGGG - Intergenic
1033604348 7:142914979-142915001 CACCAACACCAATGGGGAGGTGG - Exonic
1036182461 8:6597255-6597277 TACCATCATCACTGTCGACCCGG + Intronic
1037636762 8:20707141-20707163 TACCATAAGCAGTGTGGAGGGGG + Intergenic
1039878077 8:41604521-41604543 TACCATCACCACTGTGGAGGGGG - Intronic
1040514161 8:48120789-48120811 CAACATCAGCACTGTGCAGGTGG - Intergenic
1041079759 8:54205084-54205106 TACCATCAGCACAGTGGTGCTGG + Intergenic
1047361533 8:124173765-124173787 TACCATCTCCACTGGAGAGCAGG + Intergenic
1050144406 9:2550766-2550788 AACAATCACCACTGTGGAGGTGG + Intergenic
1056068974 9:82966209-82966231 CACCACCAGCACTGTGAAGGAGG + Intergenic
1056897073 9:90560841-90560863 TGCCATCAACACTGAGGAGTTGG - Intergenic
1060565011 9:124582901-124582923 TTGTATCATCACTGTGGAGGTGG + Intronic
1062554539 9:137107988-137108010 CACCATCCCCACTGTGGACCAGG + Intronic
1187397334 X:18930253-18930275 CACCATCACCACTGTACAGGTGG + Intronic
1188429514 X:30090280-30090302 TCCCATCAGCATTGTGGGGGGGG + Intergenic
1195027093 X:100888390-100888412 TACATACGCCACTGTGGAGGAGG - Intergenic
1197150628 X:123216664-123216686 CACCACCACCACTGAGGAGAAGG + Intronic
1199780336 X:151052378-151052400 TACCATCACCTCTGTGGCTCAGG + Intergenic
1202367436 Y:24175363-24175385 TCCCATCATGACTGTGGATGTGG + Intergenic
1202503347 Y:25494760-25494782 TCCCATCATGACTGTGGATGTGG - Intergenic