ID: 1039883476

View in Genome Browser
Species Human (GRCh38)
Location 8:41641899-41641921
Sequence CCAACTTGGAAGCAGAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039883476_1039883479 4 Left 1039883476 8:41641899-41641921 CCTGGTCTCTGCTTCCAAGTTGG No data
Right 1039883479 8:41641926-41641948 TTGAATGCTGTGTCTTCACATGG No data
1039883476_1039883483 16 Left 1039883476 8:41641899-41641921 CCTGGTCTCTGCTTCCAAGTTGG No data
Right 1039883483 8:41641938-41641960 TCTTCACATGGTGGAAGGGATGG No data
1039883476_1039883482 12 Left 1039883476 8:41641899-41641921 CCTGGTCTCTGCTTCCAAGTTGG No data
Right 1039883482 8:41641934-41641956 TGTGTCTTCACATGGTGGAAGGG 0: 42
1: 345
2: 846
3: 1417
4: 1888
1039883476_1039883484 29 Left 1039883476 8:41641899-41641921 CCTGGTCTCTGCTTCCAAGTTGG No data
Right 1039883484 8:41641951-41641973 GAAGGGATGGAAGAGCAAAAAGG No data
1039883476_1039883485 30 Left 1039883476 8:41641899-41641921 CCTGGTCTCTGCTTCCAAGTTGG No data
Right 1039883485 8:41641952-41641974 AAGGGATGGAAGAGCAAAAAGGG No data
1039883476_1039883480 7 Left 1039883476 8:41641899-41641921 CCTGGTCTCTGCTTCCAAGTTGG No data
Right 1039883480 8:41641929-41641951 AATGCTGTGTCTTCACATGGTGG 0: 8
1: 41
2: 125
3: 493
4: 1184
1039883476_1039883481 11 Left 1039883476 8:41641899-41641921 CCTGGTCTCTGCTTCCAAGTTGG No data
Right 1039883481 8:41641933-41641955 CTGTGTCTTCACATGGTGGAAGG 0: 35
1: 395
2: 976
3: 1869
4: 2652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039883476 Original CRISPR CCAACTTGGAAGCAGAGACC AGG (reversed) Intergenic
No off target data available for this crispr