ID: 1039884536

View in Genome Browser
Species Human (GRCh38)
Location 8:41647538-41647560
Sequence CAGGATCAGATGGGCTTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039884536_1039884543 11 Left 1039884536 8:41647538-41647560 CCCCTGAAGCCCATCTGATCCTG 0: 1
1: 0
2: 3
3: 22
4: 217
Right 1039884543 8:41647572-41647594 GAGACGTTGTCTTCATCTTAAGG No data
1039884536_1039884544 16 Left 1039884536 8:41647538-41647560 CCCCTGAAGCCCATCTGATCCTG 0: 1
1: 0
2: 3
3: 22
4: 217
Right 1039884544 8:41647577-41647599 GTTGTCTTCATCTTAAGGATTGG No data
1039884536_1039884545 26 Left 1039884536 8:41647538-41647560 CCCCTGAAGCCCATCTGATCCTG 0: 1
1: 0
2: 3
3: 22
4: 217
Right 1039884545 8:41647587-41647609 TCTTAAGGATTGGTAAACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039884536 Original CRISPR CAGGATCAGATGGGCTTCAG GGG (reversed) Intronic
900595797 1:3479649-3479671 CAGGCTCACTTGGGCTACAGTGG - Intronic
901643968 1:10706814-10706836 CTGGATGAGATGGGCATCAGAGG - Intronic
903344757 1:22677141-22677163 CAGGAGCAGATGGGCCGCAGTGG - Intergenic
904642695 1:31942344-31942366 CATGATTATTTGGGCTTCAGAGG - Intronic
904695348 1:32327512-32327534 TAGGATCAGAAGGGGGTCAGGGG - Intronic
905809312 1:40900166-40900188 AAGGATCACCTGGGCTCCAGTGG + Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
907334473 1:53691304-53691326 CTGGGTCAGATGGGGATCAGTGG - Intronic
909046596 1:70718009-70718031 CAGGCTCTGTTGGTCTTCAGTGG - Intergenic
909376780 1:74950457-74950479 CAGGCAGAGATGTGCTTCAGGGG + Intergenic
909820166 1:80051508-80051530 CAGGAACAGTTTGGCTTCATGGG + Intergenic
915234759 1:154472547-154472569 CCGGACCTGGTGGGCTTCAGTGG + Intronic
916087644 1:161282345-161282367 CAGCTTCAGCTGGGCATCAGAGG + Intronic
918812649 1:189140570-189140592 CAGCCTCAGCTGGGCATCAGAGG + Intergenic
1063264896 10:4436674-4436696 AAGGATCAGATGGACTTGGGAGG - Intergenic
1065250599 10:23807587-23807609 CAGGATCACATTGCCTTCAATGG - Intronic
1065383374 10:25111678-25111700 CAGGATGAGATGGGATTGAGAGG - Intergenic
1066656210 10:37701579-37701601 CCAGATAACATGGGCTTCAGCGG + Intergenic
1068871727 10:61952306-61952328 AAGGCTGAGAAGGGCTTCAGAGG - Intronic
1071016449 10:81002486-81002508 CAGGCTCAGATGGACCTCTGAGG + Intergenic
1071056787 10:81520614-81520636 CTGGAGCAGCTGGGCCTCAGAGG - Intergenic
1071059710 10:81555075-81555097 GAGGATCACTTGGGCTCCAGAGG + Intergenic
1071581494 10:86775492-86775514 CAGGGTGAGATGGGCATCAGGGG - Intronic
1072261456 10:93678742-93678764 GAGGATCACATGGGCCTCCGAGG + Intronic
1075016635 10:118914448-118914470 CAGCATCTGCTGGGCTTCTGGGG + Intergenic
1075702913 10:124480931-124480953 CAGAAACAGACAGGCTTCAGTGG - Intronic
1075927370 10:126263282-126263304 CTGGATCAGATGGTTTTCTGGGG - Intronic
1076410224 10:130244146-130244168 CAGGAGCTGATGGTCTGCAGAGG + Intergenic
1076500097 10:130930260-130930282 GAGGAGCTGATGGGCTGCAGTGG + Intergenic
1077532531 11:3103915-3103937 CTGGATGGGATGGGCTGCAGAGG - Intronic
1077549207 11:3192576-3192598 AAGGAGCAGATGGGTTTCTGTGG - Intergenic
1077839512 11:5960297-5960319 CAGCCTCAGCTGGGCATCAGAGG - Intergenic
1077909617 11:6562906-6562928 CAGGATCATAGGGTCTTCTGGGG + Intronic
1079539036 11:21549997-21550019 CAAATTCAGATGGGCTTCATGGG - Intronic
1081376906 11:42369850-42369872 CGTGATCAGGTGGGATTCAGGGG - Intergenic
1081543775 11:44055038-44055060 GAGGGTCAGATGGGCTGCTGGGG + Intronic
1085768159 11:79301882-79301904 CAGCATCTGCTGGGCTTCTGGGG - Intronic
1087531336 11:99386184-99386206 CTGTAACAGATGTGCTTCAGGGG - Intronic
1088445551 11:109923475-109923497 CAGCATCAGGTAGGCTTCAGTGG + Intergenic
1088831953 11:113544332-113544354 CAGGGTCAGCAAGGCTTCAGAGG + Intergenic
1089137541 11:116261866-116261888 GAGGATTAGAAGGGCCTCAGAGG + Intergenic
1091131594 11:133151340-133151362 AAGGATCTAATGGGCCTCAGAGG + Intronic
1091713367 12:2758826-2758848 AAGGATAAAATGGACTTCAGGGG + Intergenic
1092850164 12:12618997-12619019 CAGCCTCAGCTGGGCATCAGAGG + Intronic
1095998679 12:48111316-48111338 GAGGATCAGAAGGGCAGCAGGGG - Intronic
1096490057 12:52008176-52008198 CAGAACCAGATTGGCCTCAGGGG - Intronic
1096968114 12:55644673-55644695 AAGGATCAGATGGGCCATAGGGG - Intergenic
1101663421 12:106787680-106787702 CAGGATCTGATGGGCTTATCGGG - Intronic
1102455531 12:113068621-113068643 CAGCTTGTGATGGGCTTCAGAGG + Intronic
1102849326 12:116224765-116224787 GAGGATCAGCTAGGCTTCGGAGG - Intronic
1103009927 12:117450222-117450244 CAGGACTAGAGGGGTTTCAGAGG + Intronic
1104077127 12:125399908-125399930 GAGGATCAGATCAGCTTCACAGG + Intronic
1107911135 13:45106762-45106784 GAGAGACAGATGGGCTTCAGAGG - Intergenic
1109166490 13:59041372-59041394 CAGGATCTGCTTGGCTTCTGGGG + Intergenic
1110405307 13:75144293-75144315 GAGGCTTACATGGGCTTCAGAGG + Intergenic
1111234749 13:85394423-85394445 CAGGATCTGATCAGCTTCTGGGG + Intergenic
1111771571 13:92603016-92603038 TAGGCTCAGATGGGCTTCCTAGG - Intronic
1112169527 13:96956244-96956266 CAGCATCAGCTTGGCTTCTGGGG + Intergenic
1113328966 13:109310935-109310957 CAGCCTCAGCTGGGCATCAGAGG - Intergenic
1115203282 14:30875257-30875279 CAGGAGCAGATCGGCTGCAGGGG - Intronic
1115498907 14:34032249-34032271 CAGGATAAGATTAACTTCAGGGG + Intronic
1117817085 14:59609572-59609594 CAGGAGCTGCTGGGCTTCTGTGG - Intronic
1121081797 14:91114447-91114469 GAGGAACAGCTGGGCCTCAGTGG - Exonic
1121564342 14:94897369-94897391 AAGGATCAGATGAGCCTCTGGGG - Intergenic
1122267619 14:100554063-100554085 CAGGGCCCCATGGGCTTCAGGGG - Intronic
1122884884 14:104706499-104706521 CCCCATCAGGTGGGCTTCAGAGG + Intronic
1122901001 14:104782339-104782361 GTGGATAAGATGGGTTTCAGGGG - Intronic
1125758881 15:42083899-42083921 CAGGATGGGATTGGCTGCAGAGG + Intronic
1126012543 15:44316894-44316916 GAGGATCACATGGGCTTGGGAGG + Intronic
1128004827 15:64228926-64228948 GAGGATCACTTGAGCTTCAGAGG + Intronic
1130525531 15:84702780-84702802 CAGGCTCAGATGGTATTCACTGG + Intronic
1130978737 15:88797700-88797722 CAGGATCGCATGAGCCTCAGGGG + Intergenic
1133275571 16:4636346-4636368 CAGGATGAGATGGGATGCAATGG + Intronic
1133546047 16:6808316-6808338 CATAATCAGATGGGAATCAGTGG - Intronic
1133617595 16:7492852-7492874 CAGCATCAGTTTGGCTTCTGGGG - Intronic
1133738661 16:8634928-8634950 CACGGTCAGATGGGCGTCAGAGG - Intronic
1135254401 16:20929341-20929363 CAGAAACAGATGGGTTTCACTGG - Intergenic
1135334491 16:21589261-21589283 CCTGAAAAGATGGGCTTCAGAGG + Intergenic
1136037813 16:27553862-27553884 CAGGATCAGTTGAGCTTAGGAGG + Intronic
1136574860 16:31117548-31117570 CAGGAGCCGATTGGCTTCTGTGG - Intronic
1138340152 16:56283869-56283891 CAGAATGAGATGGGCTTGAATGG - Intronic
1138567608 16:57844993-57845015 CAAGACCATATGGGCTGCAGAGG - Intronic
1138910609 16:61393728-61393750 AAGGATGAGAAGGGCTTCAAAGG + Intergenic
1140930624 16:79624484-79624506 GAGCATCAGATAGACTTCAGAGG - Intergenic
1141579997 16:84990994-84991016 CAGGAACAGGTGGGGCTCAGGGG - Intronic
1141714682 16:85719918-85719940 CAGGAACAGAGGGGCCACAGGGG + Intronic
1142057165 16:88005206-88005228 CAGGGTCAGCTGTGCCTCAGGGG + Intronic
1143199207 17:5100501-5100523 CAGGATGCCATGGGCTCCAGGGG - Intergenic
1145158257 17:20556992-20557014 CAGCCTCAGCTGGGCATCAGAGG - Intergenic
1149101284 17:52909629-52909651 CTGCAAGAGATGGGCTTCAGTGG - Intergenic
1149252590 17:54787532-54787554 CATGATCAGTTGGTCTTGAGTGG + Intergenic
1149434724 17:56623575-56623597 CAGACTCAGATGGCCTTCAATGG + Intergenic
1149512606 17:57256204-57256226 CTGGATCACATGGGCTGCGGGGG - Intronic
1151264740 17:72946001-72946023 CAGGATCATAAGGTCTTCAAAGG + Intronic
1151349305 17:73522299-73522321 CAGGATGAGGTGGGCAGCAGAGG - Intronic
1151655958 17:75496125-75496147 GAGGATCAGATGGGCCTGCGTGG + Intronic
1152533737 17:80938138-80938160 CAGGAGCTGAGGGGTTTCAGGGG - Intronic
1155785515 18:29894858-29894880 CAGTATCAAATGAACTTCAGAGG + Intergenic
1156907651 18:42373461-42373483 CAGCATCAGCTCGGCTTCTGGGG + Intergenic
1157714884 18:49877607-49877629 CAGGATCACTTGGACTACAGTGG - Intronic
1159826839 18:73223390-73223412 CAGGAACAGATGGGATCCAGAGG - Intronic
1160038177 18:75320496-75320518 CCGCATCAGATGGGCTGGAGGGG + Intergenic
1160102376 18:75935004-75935026 CAGGGTCAGAAGGCCTGCAGAGG + Intergenic
1164597501 19:29539853-29539875 CAGGCTCACATGGGCGTGAGGGG - Intronic
1166559545 19:43723043-43723065 GAGGATCACTTGGGCCTCAGAGG + Intergenic
1202640835 1_KI270706v1_random:84638-84660 CAGGATCACATGAGCTGAAGCGG - Intergenic
925122663 2:1431352-1431374 CAGGATCTGCTTGGCTTCTGGGG - Intronic
925742815 2:7020409-7020431 GAGGGTCATGTGGGCTTCAGAGG - Intronic
927141775 2:20135884-20135906 CAGGTTCAGACAGACTTCAGGGG - Intergenic
927702734 2:25278128-25278150 CAGGAGCAGTTGGGCTGCATAGG - Intronic
928649291 2:33387909-33387931 CAGGACCAGATGGACATGAGTGG - Intronic
929747432 2:44673335-44673357 GAGGATCATTTGAGCTTCAGAGG + Intronic
930319686 2:49838574-49838596 CAAGATCAGAAGTGCTACAGAGG + Intergenic
931821911 2:65960766-65960788 CAGAATCAGATTGGCTCCATAGG + Intergenic
932582475 2:73000731-73000753 CAGGATCAGGTGGACTACTGGGG - Intronic
932656772 2:73617312-73617334 CAGGCCCAGATGGGTTTCACTGG - Intergenic
932663400 2:73677275-73677297 CAGGCCCAGATGGGTTTCACTGG - Intergenic
932794547 2:74682997-74683019 CAGGGTCAGTTGGGATGCAGAGG - Intronic
933167081 2:79088075-79088097 AAGGATCAGAAGGCCTACAGAGG + Intergenic
934548923 2:95242887-95242909 CAGGTTCGGCTGGGCATCAGAGG - Intronic
934568455 2:95353371-95353393 TGGGATCAGATCGGATTCAGAGG + Intronic
936117462 2:109713402-109713424 CAGGAGCAGATGGACTAGAGGGG + Intergenic
937025912 2:118696974-118696996 CACGATCAGATCTGCCTCAGGGG + Intergenic
938070838 2:128307349-128307371 CAGGGTCCCATGGGGTTCAGAGG + Intronic
938289214 2:130140573-130140595 AAGGGTCAGATGGGCTTCAGTGG + Intronic
938467312 2:131532365-131532387 AAGGGTCAGATGGGCTTCAGTGG - Intronic
943481835 2:188428671-188428693 CAGCATCTGCTTGGCTTCAGGGG - Intronic
946079821 2:217107943-217107965 CAGCATCTGATGGGTTGCAGAGG + Intergenic
946156751 2:217812016-217812038 GAGGATGAGATGGGCATCTGGGG - Intronic
948516614 2:238508037-238508059 CAGGAGCAGAGGGGGTGCAGGGG - Intergenic
1168806221 20:673805-673827 CAGGACCAACGGGGCTTCAGGGG + Intronic
1169835191 20:9870070-9870092 CAGGGCCACATGGGGTTCAGGGG + Intergenic
1169875925 20:10297013-10297035 CGGGAGCAGATGGCCATCAGTGG + Exonic
1172096299 20:32462183-32462205 CAGGCACAGATGGATTTCAGGGG - Intronic
1172127449 20:32633320-32633342 CACCATCAGGTGGACTTCAGTGG - Intergenic
1172614834 20:36276063-36276085 CATGAACAGATGGCCTTCAGGGG + Intergenic
1172661185 20:36570198-36570220 AAGGAGAAGATGGGCTTCTGTGG - Intergenic
1172766190 20:37352328-37352350 CCGGATCAGTTGGCCTGCAGAGG - Intronic
1172766931 20:37356007-37356029 AAGGATCAGACCGGCCTCAGAGG + Intronic
1173207586 20:41007025-41007047 CAGGTTCTTATGGGCTTCAGAGG + Intergenic
1173726415 20:45301320-45301342 CAGGACCAGAGGAGCTGCAGGGG - Exonic
1176043640 20:63081289-63081311 CAGGTTCTGCAGGGCTTCAGAGG - Intergenic
1176078267 20:63259059-63259081 CAGGCTGAGCTGGACTTCAGGGG + Intronic
1178399154 21:32268878-32268900 GAGGATCAGATGAGCTTGGGAGG - Exonic
1180182594 21:46124617-46124639 CAAGAACAGGTGGGCTTCAGTGG - Intronic
1180361117 22:11897224-11897246 CAGGATCACATGAGCTGAAGCGG + Intergenic
1180629019 22:17214512-17214534 CAGGATCAGATGGACTCCAGAGG + Intronic
1181108486 22:20588211-20588233 GAGGGTCAGATGTGCTTCAGTGG + Intergenic
1181914855 22:26271717-26271739 CAGCATCTGCTGGGCTTCTGGGG - Intronic
1184058092 22:42066038-42066060 CAGGATGAGGAGGGCCTCAGAGG + Intronic
1184114891 22:42416677-42416699 CAGGCTGAGAGGGGCTTTAGCGG + Intronic
951696110 3:25447349-25447371 AAGGATCTGATGGGGGTCAGAGG - Intronic
952022482 3:29040333-29040355 CAGGGACAGATGTGCTGCAGGGG + Intergenic
952743968 3:36760950-36760972 CAGGATCACATGGGTTTGAGGGG + Intergenic
953684073 3:45062435-45062457 CAGAATCACATGGGAGTCAGAGG - Intergenic
954225997 3:49181566-49181588 AAGGATCACATGAGCTTAAGAGG + Intronic
954852924 3:53618515-53618537 CAGGATCTAAAGGGCCTCAGAGG - Intronic
956564835 3:70624695-70624717 CAGCATCAGTTGGGCTTCTTTGG - Intergenic
966124653 3:176561991-176562013 GTGGGTCAGATGGGGTTCAGGGG - Intergenic
966862241 3:184236943-184236965 CAGGACTAAATGGGATTCAGAGG - Intronic
967921587 3:194617991-194618013 CAGCATCTGCTGGGCTTCTGGGG - Intronic
969174421 4:5387689-5387711 GAGCACCAGATGGGCATCAGAGG + Intronic
970977769 4:22060514-22060536 CAGAAGGAGCTGGGCTTCAGAGG - Intergenic
973384352 4:49495170-49495192 CAGGATCACATGAGCTGAAGTGG - Intergenic
975481511 4:74885725-74885747 CAGGATTAACTGTGCTTCAGTGG - Intergenic
980171864 4:129298833-129298855 TATGATCAGATGGGTCTCAGAGG + Intergenic
980407240 4:132368432-132368454 CAGGGCCAGAAGGCCTTCAGAGG - Intergenic
982538653 4:156639614-156639636 CAGGATCAGATGGTCTATGGGGG + Intronic
983465575 4:168084059-168084081 CTGGATAAGATTGGCTTCACTGG + Intergenic
985277656 4:188254219-188254241 GAAGATCAGATGAGCTACAGAGG - Intergenic
1202768202 4_GL000008v2_random:170493-170515 CAGGATCACATGAGCTGAAGCGG - Intergenic
985764792 5:1771566-1771588 CAGGATCAGAAGGACCTCATGGG + Intergenic
987001745 5:13666874-13666896 AAAAATCAGATGAGCTTCAGAGG + Intergenic
987092178 5:14517907-14517929 CAGGATCAGAGGGGATGCAAAGG + Intronic
988511084 5:31865400-31865422 CAGGATCACTTGGGCCTGAGAGG - Intronic
990789190 5:59457051-59457073 CAGCAGCAGTTGGGTTTCAGAGG + Intronic
991598049 5:68324511-68324533 CAGCTTCAGCTGGGCATCAGAGG + Intergenic
993305163 5:86267640-86267662 CAGGACCAGATGGATTCCAGAGG - Intergenic
994011618 5:94910890-94910912 CAGGCTCAGATGAACTTCTGTGG + Intronic
997569345 5:134914130-134914152 CAGGATCAGATGGGCAGTGGAGG + Intronic
997655261 5:135549655-135549677 CAGGATCAGGAGGGCTTCTGAGG - Intergenic
1000388028 5:160693999-160694021 CAGGGTCAGATGGCCTGCTGAGG + Intronic
1001433802 5:171683895-171683917 CAGGAGGAGGTGGGCTTCAGGGG - Intergenic
1001714518 5:173803844-173803866 CAGGATCACTTGGGCCCCAGGGG + Intergenic
1001828077 5:174762420-174762442 CAGCATCACACGGGGTTCAGAGG - Intergenic
1001832037 5:174797084-174797106 TAGGATAAGAGAGGCTTCAGTGG - Intergenic
1004321043 6:14631701-14631723 CAGGACCCCCTGGGCTTCAGAGG - Intergenic
1005779027 6:29168950-29168972 CTGGCTCTGATGGGCTCCAGTGG + Intergenic
1006278083 6:33022127-33022149 CTGGATCACATGGGCTGCGGTGG + Intergenic
1006477498 6:34266838-34266860 CAGGATCAGGTTGGCTTCATTGG + Intergenic
1007512559 6:42385262-42385284 CAGGATCAGGTCGGGTGCAGTGG - Intronic
1010081690 6:71871156-71871178 CAGGAGTAGATGGGCTTCCTGGG + Intergenic
1011781922 6:90799306-90799328 CAGCATCTGGTGGGCTTCTGGGG + Intergenic
1014285659 6:119494581-119494603 CAGGGTCAGATTGGCCTCAAAGG + Intergenic
1019694187 7:2435702-2435724 CAGGCTCAGGTGGGCTTGTGTGG + Intergenic
1019905022 7:4056331-4056353 CTGAATGAGAGGGGCTTCAGGGG + Intronic
1021261584 7:18464949-18464971 CAGGATAAGAAGGAATTCAGAGG - Intronic
1021780800 7:24103722-24103744 CAGGATCAGCTTGGATCCAGGGG - Intergenic
1023602369 7:41892542-41892564 CAGCAGCAGATGGCCTGCAGGGG - Intergenic
1024544516 7:50505990-50506012 GAGGATCAGTTGGGCAGCAGAGG + Intronic
1024903362 7:54347713-54347735 CAGGATCAGATTGGCTTATGCGG - Intergenic
1029279290 7:99426226-99426248 CAGCTTCAGCTGGGCATCAGAGG - Intronic
1029335185 7:99892863-99892885 GAGGATCAGTTGGGCAGCAGTGG - Intronic
1032161792 7:129516583-129516605 CAGCATCTGCTGGGCTTCTGGGG + Intergenic
1032667733 7:134053798-134053820 GAGGATCAGATGGGATTAAAGGG - Intronic
1032793821 7:135261684-135261706 CAGGATGTGAAGGGCTTCTGTGG + Intergenic
1033219194 7:139516798-139516820 CAGGACCTGCTGGGCTTCAAGGG + Intergenic
1036731395 8:11268768-11268790 CAGAATCAGAGAAGCTTCAGAGG + Intergenic
1037219650 8:16502281-16502303 CAGGGGCAGATGGGATTCAGAGG - Intronic
1038349295 8:26761866-26761888 CAGTAGCAGATGGGCTGCTGGGG + Intronic
1039370492 8:36979420-36979442 CATGCTCAGAGGGGCTTTAGGGG + Intergenic
1039884536 8:41647538-41647560 CAGGATCAGATGGGCTTCAGGGG - Intronic
1041872484 8:62650561-62650583 GAGGATGAGATGGGTTTTAGTGG + Intronic
1043250829 8:78071022-78071044 CAGGAGCTGATGGGCATGAGAGG + Intergenic
1044239811 8:89875650-89875672 TAGGACAAGATGGGGTTCAGGGG - Intergenic
1044427291 8:92066660-92066682 CAGTTTCAGATGGCTTTCAGTGG - Intronic
1044803854 8:95984459-95984481 CAGGTACAGATGGCCTCCAGGGG + Intergenic
1045476888 8:102560806-102560828 AAGGATCATATGGGCTGCACGGG - Exonic
1047204631 8:122793331-122793353 CAGGATCAGTGGGGCTGAAGAGG - Intronic
1047750515 8:127876985-127877007 CTGGATTAGCTGGGCTTCCGGGG - Intergenic
1053141590 9:35685828-35685850 AAGGATCAGAGAGGCTCCAGAGG + Intronic
1056000717 9:82213481-82213503 CAGCATCAGCTGGGCTTCTGGGG - Intergenic
1057816981 9:98303181-98303203 CAGGGTTAGAGGGGCTTCAGTGG + Intronic
1057941469 9:99288932-99288954 CAGGAGCTGGTGGGCTTCGGGGG + Intergenic
1059343569 9:113613201-113613223 CAGGCTCAGATGGGAGACAGAGG - Intergenic
1059812421 9:117870372-117870394 CTTTATCAGATGGACTTCAGAGG - Intergenic
1060727515 9:126016228-126016250 CAGGATCAGATGGGTTTTGGGGG + Intergenic
1061380995 9:130257540-130257562 CAGTATCACAGGGGCTTCTGGGG + Intergenic
1062248089 9:135580074-135580096 CAGACACAGCTGGGCTTCAGTGG - Intergenic
1186659905 X:11659299-11659321 CATGATCAGATGTGTTTTAGAGG - Intronic
1186750314 X:12614785-12614807 CGGGATCAGCTTGCCTTCAGAGG - Exonic
1187432279 X:19236160-19236182 CAGGATCACTTGAGCCTCAGAGG - Intergenic
1187643396 X:21319262-21319284 CAGGAAGAGATGTGCTACAGGGG - Intergenic
1187797898 X:23024462-23024484 CAAGATCAGATGGTCTTTAAGGG - Intergenic
1188570385 X:31578380-31578402 CAGGATGGCATGGGCTGCAGTGG - Intronic
1190867222 X:54394984-54395006 CATGATGAGAAGGGCTTCTGGGG - Intergenic
1191894344 X:65976002-65976024 CAGCCTCAGCTGGGCATCAGAGG + Intergenic
1194376261 X:93137330-93137352 GTGGTTCAAATGGGCTTCAGGGG + Intergenic
1195037904 X:100986930-100986952 CTGCATCAGCTGGGCTCCAGAGG - Intronic
1200099251 X:153681452-153681474 CATGATCAGGTGGGCCTCAGGGG - Intronic
1200422745 Y:2989031-2989053 CAGGATCAGGCTGGCCTCAGTGG - Intergenic
1200787895 Y:7274940-7274962 CAGGAGCAGCTGGGCTCCGGGGG + Intergenic
1201975745 Y:19847183-19847205 CATAATCACATGGGCTTTAGTGG + Intergenic