ID: 1039885425

View in Genome Browser
Species Human (GRCh38)
Location 8:41651449-41651471
Sequence TGCTGGGAAGAGGGCAGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039885413_1039885425 11 Left 1039885413 8:41651415-41651437 CCTGTGGCTGGCTTGAGAGCCTA No data
Right 1039885425 8:41651449-41651471 TGCTGGGAAGAGGGCAGCGCGGG No data
1039885412_1039885425 12 Left 1039885412 8:41651414-41651436 CCCTGTGGCTGGCTTGAGAGCCT No data
Right 1039885425 8:41651449-41651471 TGCTGGGAAGAGGGCAGCGCGGG No data
1039885420_1039885425 -8 Left 1039885420 8:41651434-41651456 CCTAGGGTGGGAGCCTGCTGGGA No data
Right 1039885425 8:41651449-41651471 TGCTGGGAAGAGGGCAGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039885425 Original CRISPR TGCTGGGAAGAGGGCAGCGC GGG Intergenic