ID: 1039887570

View in Genome Browser
Species Human (GRCh38)
Location 8:41663907-41663929
Sequence CAGGGGCGCCGCCCACGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 402}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039887570_1039887575 -10 Left 1039887570 8:41663907-41663929 CCAGGGCGTGGGCGGCGCCCCTG 0: 1
1: 0
2: 1
3: 25
4: 402
Right 1039887575 8:41663920-41663942 GGCGCCCCTGAGGGTCTGGGAGG 0: 1
1: 0
2: 2
3: 31
4: 367
1039887570_1039887581 29 Left 1039887570 8:41663907-41663929 CCAGGGCGTGGGCGGCGCCCCTG 0: 1
1: 0
2: 1
3: 25
4: 402
Right 1039887581 8:41663959-41663981 CGAGCTCACAATTGTGCACTTGG No data
1039887570_1039887579 5 Left 1039887570 8:41663907-41663929 CCAGGGCGTGGGCGGCGCCCCTG 0: 1
1: 0
2: 1
3: 25
4: 402
Right 1039887579 8:41663935-41663957 CTGGGAGGCCTGAAGACGAACGG 0: 1
1: 0
2: 2
3: 16
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039887570 Original CRISPR CAGGGGCGCCGCCCACGCCC TGG (reversed) Intronic