ID: 1039887710

View in Genome Browser
Species Human (GRCh38)
Location 8:41664741-41664763
Sequence CGCCGGAGGCCGGGGCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 1, 2: 3, 3: 30, 4: 406}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039887710_1039887718 -1 Left 1039887710 8:41664741-41664763 CCCCTCAGCCCCGGCCTCCGGCG 0: 1
1: 1
2: 3
3: 30
4: 406
Right 1039887718 8:41664763-41664785 GCCCACACCACCAGCCCTGCCGG No data
1039887710_1039887723 11 Left 1039887710 8:41664741-41664763 CCCCTCAGCCCCGGCCTCCGGCG 0: 1
1: 1
2: 3
3: 30
4: 406
Right 1039887723 8:41664775-41664797 AGCCCTGCCGGCCTCCTGCCAGG No data
1039887710_1039887726 14 Left 1039887710 8:41664741-41664763 CCCCTCAGCCCCGGCCTCCGGCG 0: 1
1: 1
2: 3
3: 30
4: 406
Right 1039887726 8:41664778-41664800 CCTGCCGGCCTCCTGCCAGGCGG No data
1039887710_1039887730 25 Left 1039887710 8:41664741-41664763 CCCCTCAGCCCCGGCCTCCGGCG 0: 1
1: 1
2: 3
3: 30
4: 406
Right 1039887730 8:41664789-41664811 CCTGCCAGGCGGTTACCTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039887710 Original CRISPR CGCCGGAGGCCGGGGCTGAG GGG (reversed) Intronic
900475828 1:2875943-2875965 CCACAGAGGCCTGGGCTGAGTGG + Intergenic
900513345 1:3070351-3070373 CGCCGGCGACCGGGGCTGCGGGG - Intronic
900581636 1:3412570-3412592 CGCCGGATGCGGGGGCCGAGGGG - Exonic
900591738 1:3463254-3463276 CCCCGGGGGCCGAGGCTGTGGGG - Exonic
900645358 1:3706452-3706474 CGCCGCAGGCCCGGGGAGAGGGG + Intronic
900645373 1:3706497-3706519 CGCCGCAGGCCCGGGGAGAGGGG + Intronic
900997446 1:6130145-6130167 TGCCTGAGGCCCGGGATGAGAGG + Intronic
901250103 1:7771482-7771504 GGACGCAGGCCGGGGCTGCGCGG + Intronic
901306998 1:8239900-8239922 CGCTGGAGGAGGGGCCTGAGAGG + Intergenic
904775063 1:32901369-32901391 GCCCGGAGCCCGGGGCTGGGCGG + Intronic
904918326 1:33986199-33986221 CCCCAGAAGCCGGAGCTGAGTGG - Intronic
906140582 1:43531507-43531529 GCCCGGAGCCCGGGGCTGGGGGG - Intronic
906805545 1:48776524-48776546 GGCCGGGGGCCCGGGCGGAGGGG - Intronic
907237412 1:53061959-53061981 GTGCGGCGGCCGGGGCTGAGAGG + Intergenic
907271224 1:53292409-53292431 CTCCAGAGCCCTGGGCTGAGAGG - Intronic
908077351 1:60535173-60535195 CTCTGTAGGCCGGGGCTGACCGG + Intergenic
910449569 1:87331657-87331679 GGGCGGAGGCGGGGGCTGGGAGG + Intronic
912422002 1:109548845-109548867 GGCTGGAGGCGGGGACTGAGTGG + Intronic
912754410 1:112312542-112312564 CCACTGTGGCCGGGGCTGAGGGG - Intergenic
914827389 1:151145769-151145791 GGCCTGAGGCCGGCGCTCAGTGG + Intronic
915217627 1:154350581-154350603 TGCCAGAGGCTGGGCCTGAGGGG - Exonic
915359443 1:155277441-155277463 CGCCGGCGCGCGGGGCGGAGGGG - Intronic
915519317 1:156432158-156432180 CCCTGGAGGAGGGGGCTGAGGGG + Intergenic
915549590 1:156624567-156624589 CGGCGGAGGTCGGGGATAAGAGG - Intronic
916134227 1:161637347-161637369 AGCTGAAGGCAGGGGCTGAGGGG + Intronic
917969109 1:180196023-180196045 CACGGAGGGCCGGGGCTGAGGGG + Intronic
917975088 1:180233250-180233272 GGCGGGAGGCCGGGACAGAGTGG - Intronic
918474144 1:184905150-184905172 GGCCGGAGTCCAGGGCTGATGGG + Intronic
919712098 1:200738942-200738964 CGGCGGCGGCGGCGGCTGAGGGG + Intergenic
920616359 1:207496374-207496396 TGCCGGTGGCCTGGGGTGAGAGG + Exonic
921067023 1:211630596-211630618 CACAGTAGCCCGGGGCTGAGGGG - Intergenic
922526674 1:226309346-226309368 GGCCGGAGGCGGCGGCGGAGGGG - Exonic
922925332 1:229342784-229342806 CGCAGGAGACTGGGGCTGAGCGG + Intronic
923171445 1:231421477-231421499 CGCCGGCGGCCAGGGCTCGGCGG - Exonic
923461665 1:234214350-234214372 CCGGGGAGGCCGGGACTGAGAGG + Intronic
924199048 1:241640491-241640513 CGCGGGGGGGCGGGGCTAAGAGG - Intronic
1062844712 10:695437-695459 GGCCTGAGGCAGGGGCTGGGGGG + Intergenic
1063418019 10:5889568-5889590 CGGGGCAGGCCGGGGCTGTGAGG - Exonic
1065099943 10:22322015-22322037 CGCGGCGCGCCGGGGCTGAGCGG - Intronic
1065756309 10:28934467-28934489 CTCCGGAGGCCGAGGCTGAGTGG - Intergenic
1067060925 10:43077526-43077548 CGCCTCGGGCCGGGGCTGGGCGG + Intronic
1069504887 10:68988990-68989012 CGCCTGAGGACGAGGATGAGCGG + Exonic
1069591786 10:69646401-69646423 GGCTGGGGGCTGGGGCTGAGAGG + Intergenic
1069698329 10:70404224-70404246 CGGCGGCGGCGGCGGCTGAGAGG + Intergenic
1069837628 10:71319275-71319297 CGCCGGAGGCAGCGGCGGCGTGG + Exonic
1070162893 10:73876376-73876398 TGCCAGAGGAGGGGGCTGAGAGG + Intergenic
1074104197 10:110376467-110376489 CGCCGGAGGCAGGAGGGGAGTGG - Intergenic
1074863991 10:117534709-117534731 TGCTGGCGGCCGGGGCTAAGCGG + Intergenic
1075046482 10:119150273-119150295 CGCTGGAGGCTGGGGCTGCTGGG + Intronic
1075451125 10:122552683-122552705 CGCTGGGGCCCTGGGCTGAGTGG - Intergenic
1075522226 10:123149708-123149730 CGCGGGACGGCGGCGCTGAGCGG + Exonic
1076700351 10:132269743-132269765 CGGGGGAGGCCAGGGCTGAAGGG - Intronic
1076792651 10:132785438-132785460 CGCCGCCGGCCGGGGCTGCAAGG + Exonic
1076798752 10:132811145-132811167 GGTCGGAGCCCGGAGCTGAGTGG - Intronic
1076998608 11:311178-311200 CGGCGGAGGCGGGTGCTCAGCGG + Intronic
1077000135 11:318581-318603 CGGCGGAGGCGGGTGCTCAGCGG - Intergenic
1077016798 11:401773-401795 GGCCGGGGGTCGGGGGTGAGCGG - Intronic
1077016810 11:401796-401818 GGCCGGGGGTCGGGGGTGAGCGG - Intronic
1077016842 11:401866-401888 GGCCGGGGGTCGGGGGTGAGCGG - Intronic
1077016874 11:401936-401958 GGCCGGGGGTCGGGGGTGAGCGG - Intronic
1077016886 11:401959-401981 GGCCGGGGGTCGGGGGTGAGCGG - Intronic
1077016918 11:402029-402051 GGCCGGGGGTCGGGGGTGAGCGG - Intronic
1077016950 11:402099-402121 GGCCGGGGGTCGGGGGTGAGCGG - Intronic
1077017012 11:402238-402260 GGCCGGGGGTCGGGGGTGAGCGG - Intronic
1077017044 11:402308-402330 GGCCGGGGGTCGGGGGTGAGCGG - Intronic
1077017056 11:402331-402353 GGCCGGGGGTCGGGGGTGAGCGG - Intronic
1077017088 11:402401-402423 GGCCGGGGGTCGGGGGTGAGCGG - Intronic
1077017120 11:402471-402493 GGCCGGGGGTCGGGGGTGAGCGG - Intronic
1077017151 11:402540-402562 GGCCGGGGGTCGGGGGTGAGCGG - Intronic
1077017177 11:402594-402616 GGCCGGGGGTCGGGGGTGAGCGG - Intronic
1077017201 11:402647-402669 GGCCGGGGGTCGGGGGTGAGCGG - Intronic
1077017260 11:402777-402799 GGCCGGGGGTCGGGGGTGAGCGG - Intronic
1077017328 11:402924-402946 GGCCGGGGGTCGGGGGTGAGCGG - Intronic
1077090760 11:777280-777302 CGCCGGAGGCCGAGGCCGCTGGG - Intronic
1077177316 11:1196726-1196748 TGCCCCAGGCCGGGGCTGGGGGG + Intronic
1077285575 11:1763862-1763884 CGGCGGCGGCCGGGTCGGAGAGG + Exonic
1077371159 11:2182252-2182274 TGCCACAGGCCAGGGCTGAGAGG + Intergenic
1077404652 11:2377626-2377648 CGCCGGGGGCCGGGGCGGGAGGG + Intronic
1077408674 11:2393640-2393662 CACTGTAGGCCGGGGTTGAGAGG - Intronic
1077501779 11:2912668-2912690 CTCCAGAGCCCAGGGCTGAGAGG + Intronic
1081574307 11:44309754-44309776 CGGCGGCGGCTGGGGCTGCGGGG + Exonic
1081856634 11:46308139-46308161 AGGCGGAGGCCTGGGCTGGGCGG - Intronic
1082238973 11:49852312-49852334 CGCCAGAGGCCGGTGCCGAAGGG + Intergenic
1082811605 11:57482278-57482300 CGCTGGTGCCCGGGGATGAGAGG - Intergenic
1083940001 11:65890692-65890714 AGCCGGAGCCCGAGCCTGAGTGG + Exonic
1083967577 11:66052077-66052099 GGCCGGAGGGCGGGGCTGCGAGG - Intronic
1084089502 11:66870723-66870745 AGCTGGAGGCGGGAGCTGAGAGG - Intronic
1084457796 11:69278354-69278376 TCCCGGAGGCCGGGGCTGTGGGG + Intergenic
1084527047 11:69704143-69704165 GGCCGGAGGCGGGGTGTGAGTGG - Exonic
1084554715 11:69868833-69868855 GTGCGGAGGCTGGGGCTGAGCGG - Intergenic
1084558738 11:69890783-69890805 AGCCTGAGGCCTGTGCTGAGAGG + Intergenic
1085477907 11:76799299-76799321 GGCAGGAGGCCAGGGCTGCGGGG - Intergenic
1086107032 11:83157456-83157478 CGGCCGAGGCCGGTGCTGCGGGG + Exonic
1089173879 11:116534779-116534801 CGGCGGAGGCCGGGGAGGTGAGG - Intergenic
1089456282 11:118627787-118627809 CCCCGGAGGCCAGGGCTGGGAGG - Exonic
1089630315 11:119780124-119780146 CCCTGGAGGCAGGGGCTGGGGGG + Intergenic
1092193347 12:6535200-6535222 TGCCGGAGGCCGTGGGGGAGGGG - Intronic
1092237972 12:6821731-6821753 CCTGGGAGGCCGGGACTGAGGGG + Exonic
1092810392 12:12266919-12266941 CGCGCGAGCCCGGGGCCGAGCGG - Intronic
1093732498 12:22581789-22581811 CTCAGGAGGCCGCGGCTGTGAGG + Intergenic
1094607203 12:31959324-31959346 CGCCCGAGGCGGTGGCTGCGAGG - Intergenic
1095951663 12:47785030-47785052 CGCCTGTGGCCAGGACTGAGGGG + Intronic
1095958522 12:47819689-47819711 GGCCGGAGGCCGAGCCTGGGCGG + Intronic
1096977517 12:55707934-55707956 GGCCGGAGGCGGGGCCTGAGTGG - Intronic
1097019184 12:56007786-56007808 AGCCGGGGGCGGGGCCTGAGGGG + Intronic
1097339518 12:58421343-58421365 GGCTGGAGGCCGGGACTGACAGG + Intergenic
1097357821 12:58621301-58621323 CTGCTGAGGCCAGGGCTGAGTGG - Intronic
1099294770 12:80816333-80816355 CCCAGGAGGTCGGGGCTGTGGGG + Intronic
1100315475 12:93441487-93441509 CGCCGGAGGCCGCGGGCGCGCGG - Intronic
1103008290 12:117439027-117439049 TACTGGAGGCCGGAGCTGAGGGG - Intronic
1103048547 12:117759650-117759672 CGGTGGATGCCAGGGCTGAGGGG - Intronic
1103368171 12:120398238-120398260 CTCAGGAGGCGGGGGCTGGGTGG - Intergenic
1103649527 12:122422315-122422337 CGCCGGAGGCCGGGGGTCCCTGG - Intronic
1103817615 12:123671345-123671367 CTCGGTGGGCCGGGGCTGAGGGG + Intronic
1104857357 12:131908405-131908427 AGCTGCAGCCCGGGGCTGAGTGG + Intronic
1105221113 13:18328595-18328617 CACTGAAGGCTGGGGCTGAGAGG - Intergenic
1105767955 13:23579476-23579498 GGCCGGAGCCCGAGGCTCAGGGG - Exonic
1110892389 13:80707503-80707525 CCCGCGAGGCCGGGACTGAGAGG + Intergenic
1113311939 13:109140666-109140688 CGCCGGAGGACGAGGCGGCGGGG + Exonic
1114600778 14:23953972-23953994 CACCGGAGGCCGAGGATGAGAGG - Intronic
1117545913 14:56794745-56794767 CGTCGGAGGCCTGGGTTGGGGGG + Intergenic
1119519683 14:75277061-75277083 CGCCGGGTCCGGGGGCTGAGCGG - Intergenic
1122652323 14:103232503-103232525 GGCCGGAGGGCAGGGCTGGGAGG + Intergenic
1122858644 14:104572233-104572255 CCCCGAAGCCCTGGGCTGAGTGG + Intronic
1122897820 14:104769105-104769127 CTCCAGAGGCCTGGCCTGAGGGG - Intergenic
1122908658 14:104815705-104815727 GGCAGGCGGCCGGGGCTGCGCGG - Intergenic
1123051735 14:105547315-105547337 CGCAGCAGGCCGAGGCTGAGGGG + Intergenic
1123077149 14:105673018-105673040 CGCTGCAGGCCGAGGCTGAGGGG + Intergenic
1123162033 14:106287678-106287700 CGCCAGAGGCCGGGTCGGAGCGG - Intergenic
1124014619 15:25864368-25864390 CCCAGGAGGCCGTGGCTGGGCGG + Intronic
1124250987 15:28106560-28106582 GGCCGGAGGCCGGGGCCCGGAGG - Intergenic
1125506895 15:40272364-40272386 GGCCTGTGGCCGGGGCTGTGCGG - Exonic
1127165712 15:56243588-56243610 CGTCAGCGGCCGGGGCTGTGGGG + Intergenic
1128501307 15:68229375-68229397 CGGCGCTGGCCGGGGCGGAGCGG - Intronic
1129331821 15:74831828-74831850 CACCTGTGGCAGGGGCTGAGGGG + Intergenic
1130928350 15:88401854-88401876 TGCCGGGGGCCCAGGCTGAGTGG - Intergenic
1130961010 15:88658674-88658696 CGCAGCAAGCTGGGGCTGAGTGG - Intergenic
1132098437 15:99005572-99005594 CGCCGGGGACCGGGGTGGAGCGG + Intronic
1132620900 16:867898-867920 AGCCGGAGGGCGGGGATGGGAGG - Intronic
1132675816 16:1120871-1120893 CGCCGGTGTCCGGGGCTGCCTGG + Intergenic
1132852099 16:2029411-2029433 CGCTGGAGTCCGGGGGTGGGGGG + Intronic
1132877932 16:2148573-2148595 GGCGGGAGGCCGGGCCTGAGTGG + Intronic
1132893273 16:2214905-2214927 CGCGGGAGGCGGGGGCGGATTGG - Intergenic
1133924600 16:10182620-10182642 CGCGGGACGCCGGGCCTGGGAGG - Intronic
1134208848 16:12259398-12259420 GGCTGGAGGCAGGGGCAGAGAGG - Intronic
1134567868 16:15266664-15266686 TGCCCGGGGCTGGGGCTGAGGGG - Intergenic
1134734567 16:16489689-16489711 TGCCCGGGGCTGGGGCTGAGGGG + Intergenic
1134932899 16:18222217-18222239 TGCCCGGGGCTGGGGCTGAGGGG - Intergenic
1136544652 16:30948497-30948519 CCCCGGAGGCCTGCGCGGAGGGG - Exonic
1136547144 16:30961557-30961579 CGCTGGAGGCCAAGCCTGAGTGG - Intronic
1136580525 16:31148645-31148667 CGCTGGAGCCCGCGGCCGAGTGG - Exonic
1136784288 16:32925526-32925548 CGGCGGCGGCGGGGGCTGTGGGG + Intergenic
1136885496 16:33928280-33928302 CGGCGGCGGCGGGGGCTGTGGGG - Intergenic
1137288781 16:47037748-47037770 CTCCGGAGGCGGCGGCTGGGAGG + Intergenic
1137712260 16:50574595-50574617 CGCTGGAGGCCAGGCCTGCGAGG - Intronic
1138178744 16:54928896-54928918 AGCCGGGGGCGGGCGCTGAGGGG + Intergenic
1139549596 16:67666281-67666303 GGGCGGAGTCCGGGGCTCAGAGG + Intronic
1139651759 16:68365761-68365783 AGCAGGAGGTCGGGGCAGAGGGG - Intronic
1139974794 16:70800979-70801001 CGCCGGCGCCGGGGGCAGAGCGG - Exonic
1141141600 16:81500114-81500136 CGCCAGAGGCTGGGGCTGGCAGG - Intronic
1141839638 16:86566668-86566690 CCGCGGAGGCCGGGGCGGCGGGG + Intergenic
1141950222 16:87335035-87335057 CCAGGGTGGCCGGGGCTGAGCGG + Intronic
1142136416 16:88453761-88453783 CGCCGGCGCCCAGGGCAGAGCGG - Intronic
1142156233 16:88533929-88533951 CGCGGGCGGCCGGGGCAGCGAGG + Exonic
1142190130 16:88713623-88713645 TGCGGGAGGCAGGGGCTGTGTGG - Intronic
1142349889 16:89575196-89575218 CCCCCGAGGCCGGGGCGGGGCGG - Intergenic
1203086945 16_KI270728v1_random:1189532-1189554 CGGCGGCGGCGGGGGCTGTGGGG + Intergenic
1142659453 17:1417768-1417790 CTCCGGAGGCCGAGGCAGAGTGG - Intergenic
1142875786 17:2851575-2851597 CTCAGGAGTCAGGGGCTGAGAGG + Intronic
1143102344 17:4511420-4511442 GGCCGGAGGGCGGGGCTGGCAGG + Intronic
1143108091 17:4539377-4539399 AGATGGAGGCAGGGGCTGAGGGG + Intronic
1144770665 17:17757706-17757728 CGCCTGCGGCGGGGGCTGTGTGG - Intronic
1144780982 17:17808295-17808317 CGCAGGAGGCAGGGGCAGAGAGG - Intronic
1144829523 17:18123453-18123475 GGCCGGAGGCCAGGGCCGAAAGG + Intronic
1146403701 17:32519606-32519628 CGCGGCCGGCCGGGGCTGCGGGG - Intronic
1147392977 17:40121820-40121842 GAGGGGAGGCCGGGGCTGAGGGG - Intergenic
1148209551 17:45799989-45800011 AGCTGGAGGTCGGGGCAGAGTGG - Intronic
1148440405 17:47709001-47709023 CGGCGGTGGCCGGGGCTGCGGGG - Exonic
1148495056 17:48048550-48048572 TGCAGGAGGCGGGGGCCGAGCGG + Intronic
1149568097 17:57653481-57653503 CCCCGGGGCCCGGGGCTGGGGGG - Intronic
1151578655 17:74965177-74965199 CGCTGGAGGTGGGCGCTGAGAGG - Intronic
1151682259 17:75628385-75628407 CGACGGAGGGCTTGGCTGAGGGG + Exonic
1152088145 17:78232445-78232467 AGCCGGAGGAGGGGGCTGTGGGG + Intronic
1152245614 17:79183229-79183251 GGCCGGGGGCCGGGGCCGGGCGG + Intronic
1152576470 17:81143475-81143497 CACGGGAGGCAGGGGCTGCGTGG - Intronic
1152734896 17:81992522-81992544 CTGGGGAGGCCTGGGCTGAGGGG - Intronic
1153275089 18:3360451-3360473 GGCCAGAGGCCGGGCCCGAGGGG - Intergenic
1154106138 18:11524852-11524874 CGCCGGAGGCTTGGTCTGACTGG + Intergenic
1155325216 18:24657898-24657920 CGTCAAAGGCAGGGGCTGAGTGG - Intergenic
1155422820 18:25673756-25673778 CGCCAGAGGCTGGGGGTGATCGG - Intergenic
1157610648 18:48952767-48952789 AACCGGAGCCCGGAGCTGAGAGG - Intergenic
1158652293 18:59299009-59299031 CTCCGGAGGCTGGCGCGGAGTGG - Intronic
1160497534 18:79384021-79384043 CACAGGAGGCTGGGGCAGAGGGG - Intergenic
1160699058 19:497531-497553 CGGAGGAGGCAGGGGCTGAGAGG + Intronic
1160706713 19:533291-533313 CGCAGCTGGCCGGGGCAGAGCGG - Intronic
1160768844 19:821571-821593 CGCCGCAGGCCGTGGCTGGAGGG + Exonic
1160774905 19:850916-850938 CGCCTGAGGCAGGGGCTGGGCGG - Intergenic
1161031812 19:2061200-2061222 CGCCAAATGCCGGGGCTGATCGG + Intergenic
1161293128 19:3506400-3506422 GGCCGGAGGCGGGCGCTGTGCGG + Intronic
1162334690 19:10053073-10053095 TGCCTGAGGCGGGGGCTGGGGGG - Intergenic
1162506629 19:11089765-11089787 CGCTGGAGGGGGGCGCTGAGGGG + Intronic
1162751755 19:12833843-12833865 CGGCGGCGGCGGCGGCTGAGGGG - Intronic
1162959505 19:14117684-14117706 CGCGGGAAGCAGGGGCTGGGCGG - Exonic
1163019435 19:14474617-14474639 TGCCTGAGGGCGGGGCTGGGGGG - Intronic
1163228884 19:15985365-15985387 TACTGGAGGCCAGGGCTGAGGGG + Intergenic
1163243309 19:16077046-16077068 CGCCGGGGTCCCGGGCCGAGGGG + Intronic
1163708627 19:18832383-18832405 CGCGGGAGGCCCGGGCGGCGCGG + Exonic
1165049865 19:33134578-33134600 CGCCAGAGGCGGGGGCGGTGCGG + Intronic
1165349376 19:35268053-35268075 CACCGGAGTCCGGGGCCGGGAGG + Intergenic
1165578004 19:36838274-36838296 GGCCCGAGGCCGGGGCTGAGGGG - Intronic
1166621423 19:44304844-44304866 CGCTGGAGGGCGGGGTTGGGAGG - Intronic
1167446743 19:49542532-49542554 CGCTGGGGGCCGGGACAGAGGGG - Exonic
1168337452 19:55604671-55604693 GGCCGGGGGCCGGGGCTTAAAGG + Intergenic
925376124 2:3387676-3387698 CTCCGGAGGCGCGAGCTGAGGGG - Exonic
925752031 2:7097367-7097389 CGCAGGACGCCGAGGCTAAGGGG + Intergenic
925909649 2:8565515-8565537 CACGGGAGGCCGGGCCAGAGGGG - Intergenic
927153017 2:20206339-20206361 TTCCTGAGGCCGGGGCTGACTGG + Intronic
927554339 2:24021850-24021872 GGCCTGAGGCTGGGGCAGAGGGG - Exonic
927677507 2:25117187-25117209 AGCCGCAGGCAGGGGCTGACGGG - Intronic
928093910 2:28392666-28392688 GGCCGGGAGCCGGGGCTGGGAGG + Intronic
928262368 2:29779307-29779329 CACCTGGGGCCTGGGCTGAGTGG + Intronic
931241156 2:60453543-60453565 CAGCGGAGACCTGGGCTGAGGGG + Intronic
932212737 2:69945770-69945792 CACCTGAGGCCAGGTCTGAGCGG + Intergenic
932621121 2:73265455-73265477 CGCCGCAGGCCTGAGCTGCGAGG + Exonic
935222874 2:101029678-101029700 AGACGGACGCCAGGGCTGAGAGG + Exonic
935731064 2:106065460-106065482 CGCCGGCGGCGGGGGCCGCGTGG - Intronic
936140111 2:109932150-109932172 GGCCTGAGGACAGGGCTGAGAGG + Intergenic
936176800 2:110230095-110230117 GGCCTGAGGACAGGGCTGAGAGG + Intergenic
936204585 2:110439336-110439358 GGCCTGAGGACAGGGCTGAGAGG - Intronic
937283492 2:120736081-120736103 CGCCGGCGGTAGGGGCTGCGCGG + Intronic
937868134 2:126769165-126769187 CACCGGAGGCAGGAGCTGTGAGG - Intergenic
940883303 2:158968484-158968506 CGCCGCAGCCCGGGGCGGGGAGG + Intergenic
941188309 2:162344399-162344421 CGCCGGATTCCGGGGCTGTTGGG + Intronic
942459100 2:176157409-176157431 CGCCGGGGGCCGGGGGTGGAGGG - Intronic
945119371 2:206442911-206442933 CGCCGCAGGCTGGCGCGGAGTGG - Intergenic
947143542 2:227042228-227042250 CACGGGATGCCTGGGCTGAGGGG - Exonic
947750719 2:232530630-232530652 TGCCGGGGGCAGGGGCTGGGTGG - Intronic
948046987 2:234952304-234952326 CGCCTGAGTTCGGGGCTGCGCGG + Intronic
948209041 2:236178831-236178853 CGGCGGAGGCCGGGGAGGCGGGG - Intergenic
948645358 2:239400823-239400845 CGCCGGGGGCCCAGGCTGGGAGG + Exonic
948945911 2:241218525-241218547 CGCCGTGGGCAGGGGCTGGGGGG + Intronic
949014519 2:241701999-241702021 CGCGGGAGGCGGGGGCGGGGCGG - Intergenic
949052494 2:241904589-241904611 CGCAGCAGGCAGGAGCTGAGTGG + Intergenic
1169164217 20:3408012-3408034 CGCTGGAGGCCGGGGCTGGTCGG - Intergenic
1169171882 20:3471551-3471573 AACCAGAGGCTGGGGCTGAGGGG + Intronic
1169236872 20:3936687-3936709 TGTCGGAAGGCGGGGCTGAGAGG - Intronic
1169267430 20:4175095-4175117 CTCCGTAGGCCGCGACTGAGAGG - Exonic
1172126305 20:32627124-32627146 CCCCGGAGGCCGGGGGAGGGGGG - Intergenic
1172782187 20:37443473-37443495 GGGCTGAGGCAGGGGCTGAGGGG - Intergenic
1173120791 20:40287255-40287277 CGCCGGCGCCCGGGTCAGAGGGG - Intergenic
1173495541 20:43514920-43514942 AGGCGGAGGCAGGGCCTGAGGGG + Intronic
1173684009 20:44910117-44910139 GGCAGGGGGCCGGGGCTGCGGGG - Exonic
1174204306 20:48827945-48827967 CGCCGGCGGGCCGGGCTCAGCGG + Intergenic
1174362990 20:50040146-50040168 CCCCGGAGGCTGAGGCTAAGAGG + Intergenic
1175737043 20:61394336-61394358 CGCTGGTCGCTGGGGCTGAGAGG - Intronic
1175859670 20:62143522-62143544 CACCGGTGGCCGGGGGTGGGAGG + Intergenic
1175922660 20:62457391-62457413 CCCCGGAAGCAGGTGCTGAGAGG - Intergenic
1175927115 20:62476303-62476325 CGGCGGGGGCCGGGGCAGGGAGG - Intergenic
1176047109 20:63098455-63098477 AGCCGGAAGAAGGGGCTGAGTGG - Intergenic
1176143143 20:63553891-63553913 CGCCCGAAGCCGGGGGTGCGTGG + Exonic
1179197890 21:39183159-39183181 CGCCTAAGGCCGGGGCTCCGCGG - Intronic
1179529736 21:42010432-42010454 CGCCGGAGGGCGGGGCGGGGGGG + Intergenic
1179833407 21:44012405-44012427 AGCCGGAGCCCGAGCCTGAGCGG - Exonic
1182299068 22:29328041-29328063 GGCAGGAGGCCTGGGCTCAGAGG + Exonic
1182445462 22:30387152-30387174 AGCCGGCGGCCGGGGCGGGGCGG - Exonic
1182567687 22:31212316-31212338 CGGCGGCGGCAGGAGCTGAGGGG + Intronic
1182714143 22:32341393-32341415 CGGAGGAGGGAGGGGCTGAGGGG - Intergenic
1182734025 22:32518111-32518133 CACAGGGGGCCGGGGCTGTGAGG + Exonic
1183432410 22:37773740-37773762 GGGCTGAGGCCTGGGCTGAGGGG - Intronic
1183444470 22:37844061-37844083 CGCCGGACGCCCGGCCCGAGAGG + Exonic
1183578256 22:38706159-38706181 CGGCGGCGGCGGGCGCTGAGGGG + Intronic
1184034293 22:41911187-41911209 CGGTGGCGGGCGGGGCTGAGCGG - Intronic
1184401459 22:44276983-44277005 CGGAGGAGGGAGGGGCTGAGGGG - Intronic
1184664353 22:45979263-45979285 CGGAGAAGGGCGGGGCTGAGCGG + Intergenic
1185055114 22:48575405-48575427 GGCCGGAGTCCGAGGCTGCGCGG + Intronic
1185094801 22:48800415-48800437 GGAGGGAGGCCTGGGCTGAGGGG - Intronic
1185313505 22:50169524-50169546 GGACGGAGGGCGGGGCTGTGGGG + Intergenic
1185345081 22:50307461-50307483 CGCGGCAGGCCCGGGCGGAGCGG + Intronic
1185409383 22:50674294-50674316 CGCCGGAGGCGGGGGCCGGGAGG - Intergenic
949559361 3:5187917-5187939 CGCTGGAAGCCGAAGCTGAGCGG - Exonic
953311887 3:41888644-41888666 CCCCGGAGGCCAGGGCTGCAGGG - Intronic
953913250 3:46903423-46903445 GGCAGTAGGCGGGGGCTGAGGGG - Exonic
953979515 3:47406635-47406657 CGGGGCAGGGCGGGGCTGAGTGG + Intronic
953990082 3:47476887-47476909 GGCAGTAGGCAGGGGCTGAGGGG - Intronic
954402833 3:50328027-50328049 GGCCGGAGGCGGCGGCTCAGAGG - Exonic
954664689 3:52245658-52245680 GGGCGGAGGTCGGGGCTGGGGGG + Intergenic
956568326 3:70665010-70665032 GGCTGGAGGCAGTGGCTGAGTGG + Intergenic
961736278 3:129003894-129003916 CGGCGGAGGCCCGCGCTGGGCGG + Exonic
965576442 3:170222626-170222648 CGCTGGAGGCCGGGGGTGCGGGG - Exonic
966914306 3:184576413-184576435 CACCGAAGGCCAGGGCAGAGAGG - Intronic
968010504 3:195271129-195271151 CGCCTGGCGCCGGGGCTAAGTGG - Exonic
968090554 3:195895937-195895959 CGCGGGAGGCGGGCGCTGGGAGG - Intronic
968510556 4:993649-993671 AGCGGGAGGCGGGGGCTCAGGGG + Intronic
969099774 4:4760186-4760208 CGGAGGAGGCTGGGGCTGTGTGG - Intergenic
969411814 4:7033505-7033527 CTCAGGAGGCCGTGGCTGTGTGG + Intergenic
969413058 4:7042447-7042469 CCCCGGAGGCCGAGACAGAGCGG - Exonic
969873135 4:10116804-10116826 GGTCCGAGGCCGGGGCTCAGAGG + Exonic
975779056 4:77819919-77819941 CGCCGGCGGCCGCGGCCGCGGGG - Intergenic
976226395 4:82798266-82798288 CCACGGAGGCCGGGGCGCAGGGG + Intronic
977536655 4:98261731-98261753 CGCCGGGTGCCGGGGCTGGGAGG + Intronic
977885729 4:102250373-102250395 CGCAGGAGCCCGCGGCTGCGGGG + Intergenic
978126960 4:105146604-105146626 CGGCGCAGGCCGGGGCGGAGCGG + Exonic
980969982 4:139558588-139558610 CGGCGGGGGCCGGGGTTGGGGGG - Intronic
982245210 4:153344507-153344529 GGCCTGGGGCCGGGGCTGTGGGG - Intergenic
985472382 5:53937-53959 GCCCGGGGGCCGGGGCCGAGGGG + Intergenic
985688456 5:1294322-1294344 TGGCGGGGGCCGGGCCTGAGTGG + Exonic
985733478 5:1564357-1564379 CGCCTGCTGCCGGGGCTGACTGG + Intergenic
992039700 5:72817200-72817222 CGCAGGAGACCCGGGCAGAGGGG - Intronic
993457333 5:88141560-88141582 GGCCGGGGGCTGGGTCTGAGAGG + Intergenic
997965519 5:138353009-138353031 CACTCGAGGCCGGGGCTGCGGGG + Intronic
999428143 5:151505020-151505042 CGACTGAGGCAGGGGCAGAGGGG + Exonic
999753986 5:154650910-154650932 AGGCGGAGACTGGGGCTGAGAGG + Intergenic
1001127905 5:169037086-169037108 CGATGGAGGTGGGGGCTGAGTGG - Intronic
1001525465 5:172425605-172425627 TGCGGGAGGAAGGGGCTGAGCGG + Intronic
1002006402 5:176238330-176238352 CGCCGGTGGGCGGGGCTTGGCGG + Intergenic
1002189167 5:177469903-177469925 GGCAGGAGGCTGGGGCTGTGAGG + Intronic
1002219978 5:177672307-177672329 CGCCGGTGGGCGGGGCTTGGCGG - Intergenic
1002293441 5:178214908-178214930 CTCAGGAGGCCAGGCCTGAGGGG + Intronic
1002526096 5:179816940-179816962 AGCCGGCGGGAGGGGCTGAGAGG - Intronic
1002541315 5:179908003-179908025 CGCCCGAGGCCGGGGCTGAGGGG - Intergenic
1002635602 5:180606539-180606561 AGCCACAGGCCTGGGCTGAGCGG + Intronic
1003175602 6:3750950-3750972 CGGGGGCGCCCGGGGCTGAGCGG - Intronic
1004410828 6:15380030-15380052 GGTCGGGGGCCGGGGGTGAGGGG + Intronic
1004426655 6:15511408-15511430 TGCTGGAGGCGGTGGCTGAGTGG - Intronic
1004504676 6:16238485-16238507 CGCCTCAGGCAGGGGTTGAGAGG - Intergenic
1005554182 6:26956624-26956646 CGCGGGAGCCCGCGGCTGGGGGG + Intergenic
1006304936 6:33213234-33213256 CGCCGGGCAGCGGGGCTGAGCGG + Intergenic
1006333897 6:33410779-33410801 GGTCGGAGGAAGGGGCTGAGGGG + Intronic
1006634576 6:35452640-35452662 CGCTGCAGGCGGGGCCTGAGGGG + Exonic
1006725407 6:36196539-36196561 CGGCGGCGGCCGGGGCGGTGCGG - Intergenic
1006776533 6:36597179-36597201 CCCCGGAGGCCGAGGTTGCGGGG - Intronic
1006795385 6:36728978-36729000 CTCCAGAGGCCAGGGCTGTGTGG - Intronic
1006951011 6:37820452-37820474 CTCCGGAGGACGGGGAGGAGGGG - Intronic
1007327651 6:41073800-41073822 GGCCGGAGACCCGGGCGGAGCGG - Intronic
1007390454 6:41547175-41547197 AGCCGGAGGCCGGGGCGGGGAGG + Intronic
1014551029 6:122789658-122789680 GCCGGGAGGCCGGGGCTGGGCGG + Intronic
1016982292 6:149864279-149864301 CGCCGCAGGCCGGGGCGGAGAGG - Intergenic
1017942495 6:159065345-159065367 TGCCGGTGACAGGGGCTGAGTGG - Intergenic
1018655047 6:166026607-166026629 CGCTGGGAGCAGGGGCTGAGAGG - Intergenic
1018737855 6:166702296-166702318 CGCCGGGGGCTTGGGCAGAGGGG - Intronic
1019139967 6:169936904-169936926 AGACGGAGGCTGGGGCTGGGGGG - Intergenic
1019174719 6:170154245-170154267 GGGAGGAGGCCGGGGCTGTGAGG - Intergenic
1019198521 6:170296196-170296218 CGCCGGGACCCGGGGCTGGGGGG + Intronic
1019279440 7:192678-192700 CCCGGGAGACCGGGGCTGGGGGG - Intergenic
1019487439 7:1295881-1295903 CCCCAGAGGCTGGGGCTGGGTGG - Intergenic
1019540213 7:1547955-1547977 CGTCTGGGGCTGGGGCTGAGCGG - Intronic
1019577678 7:1745420-1745442 CGGCGGAGGCGGGGGCGGCGGGG - Exonic
1019711134 7:2518853-2518875 CGCCGGCAGCCGAGGGTGAGGGG - Intronic
1019989604 7:4682436-4682458 GGGCGGAGGCTGGGGCTGCGCGG - Exonic
1019995088 7:4718883-4718905 CCCCGGAGGCGGAGGCTGTGGGG - Intronic
1020431518 7:8120879-8120901 AGCCGAAGCCCGGGGCTGGGAGG + Intronic
1021704276 7:23351455-23351477 CGCCGGGGGCTTGGGCAGAGGGG - Exonic
1022471155 7:30682531-30682553 CGCCGGGGGGCGGGGCCGGGCGG + Intronic
1022782855 7:33603328-33603350 CGGTGGTGGCAGGGGCTGAGGGG - Intronic
1023255834 7:38311457-38311479 TGCCGGAGGCGGTGGCTGTGTGG - Intergenic
1023382642 7:39623771-39623793 CTCCGGAAGCCGCGGCTGCGTGG - Exonic
1023940392 7:44765542-44765564 CGCTGGGGGCAGGGACTGAGGGG - Exonic
1023955756 7:44885460-44885482 CGGCGGCGGCCGGCGATGAGCGG - Intergenic
1026968287 7:74453916-74453938 CGGCGGAGGGCGGGGCGGCGCGG - Intronic
1027202213 7:76071512-76071534 AGCCGAAGGCGGGGCCTGAGAGG + Intergenic
1027592544 7:80134709-80134731 CGCCGGGGTCCGGGGCCGGGGGG + Intronic
1029111188 7:98213748-98213770 CGGCGGTGGCAGGGGCTGGGTGG - Intergenic
1029177398 7:98674737-98674759 GGCTGGAGGCCGGGGCTCCGAGG + Intergenic
1029305566 7:99617137-99617159 CGCCCTCAGCCGGGGCTGAGCGG - Intronic
1029708287 7:102286726-102286748 GGCCGGGGGCGGGGCCTGAGCGG + Intronic
1031165706 7:118224742-118224764 GGCCGGATGCCAGGGCAGAGGGG + Exonic
1032091784 7:128915049-128915071 GGCCTGGGGCTGGGGCTGAGGGG - Intergenic
1032298772 7:130668325-130668347 CGCCGGAGGCCCGCGCGCAGGGG + Intronic
1033186638 7:139232073-139232095 TGCGGGGGGCCGGGGCCGAGCGG + Intronic
1033219283 7:139517475-139517497 TGCCAGAGGCCGGGGGTGAGGGG + Intergenic
1034254078 7:149714926-149714948 GGCCGGGGGCCTGGGCCGAGGGG - Intronic
1034560379 7:151876266-151876288 CGCCTGGGGCGGGGGCTGGGCGG - Intronic
1036263096 8:7255773-7255795 CGACGGAGGAAGGGGCGGAGAGG - Intergenic
1036264399 8:7263396-7263418 CGACGGAGGAAGGGGCGGAGAGG - Intergenic
1036265694 8:7271018-7271040 CGACGGAGGAAGGGGCGGAGAGG - Intergenic
1036266999 8:7278640-7278662 CGACGGAGGAAGGGGCGGAGAGG - Intergenic
1036268302 8:7286262-7286284 CGACGGAGGAAGGGGCGGAGAGG - Intergenic
1036269606 8:7293884-7293906 CGACGGAGGAAGGGGCGGAGAGG - Intergenic
1036298287 8:7553173-7553195 CGACGGAGGAAGGGGCAGAGAGG + Intergenic
1036299592 8:7560823-7560845 CGACGGAGGAAGGGGCAGAGAGG + Intergenic
1036300897 8:7568469-7568491 CGACGGAGGAAGGGGCAGAGAGG + Intergenic
1036302203 8:7576117-7576139 CGACGGAGGAAGGGGCAGAGAGG + Intergenic
1036303494 8:7583761-7583783 CGACGGAGGAAGGGGCAGAGAGG + Intergenic
1036315134 8:7714313-7714335 CGACGGAGGAAGGGGCGGAGAGG - Intergenic
1036316442 8:7721959-7721981 CGACGGAGGAAGGGGCGGAGAGG - Intergenic
1036317749 8:7729607-7729629 CGACGGAGGAAGGGGCGGAGAGG - Intergenic
1036319058 8:7737255-7737277 CGACGGAGGAAGGGGCGGAGAGG - Intergenic
1036320366 8:7744902-7744924 CGACGGAGGAAGGGGCGGAGAGG - Intergenic
1036321674 8:7752550-7752572 CGACGGAGGAAGGGGCGGAGAGG - Intergenic
1036322984 8:7760198-7760220 CGACGGAGGAAGGGGCGGAGAGG - Intergenic
1036324287 8:7767847-7767869 CGACGGAGGAAGGGGCAGAGAGG - Intergenic
1036351753 8:8016460-8016482 CGACGGAGGAAGGGGCGGAGAGG + Intergenic
1036353054 8:8024106-8024128 CGACGGAGGAAGGGGCGGAGAGG + Intergenic
1036354348 8:8031753-8031775 CGACGGAGGAAGGGGCAGAGAGG + Intergenic
1036868351 8:12419183-12419205 CGACGGAGGAAGGGGCAGAGAGG + Intergenic
1038002325 8:23402969-23402991 AGCCGGAGTGCGGGGCGGAGCGG - Intronic
1039454292 8:37697282-37697304 AGGCGGCGCCCGGGGCTGAGCGG - Exonic
1039887710 8:41664741-41664763 CGCCGGAGGCCGGGGCTGAGGGG - Intronic
1040059703 8:43093657-43093679 GGCAGGCGGCCGGGGCTGCGGGG - Intronic
1041689754 8:60678217-60678239 CGGCGGCGGCCGGGGGTGACTGG - Intergenic
1042722641 8:71842256-71842278 CGCGAAAGGCCGGGGCTGTGTGG + Exonic
1043296214 8:78666292-78666314 CTCCGGAGGCTGGGGCCGAAGGG + Intronic
1045021224 8:98045887-98045909 CGCCGGAGGCTGAGGCGGAGAGG + Intronic
1047313982 8:123715607-123715629 TGCCTGAGGCCCTGGCTGAGGGG + Intronic
1048553997 8:135457667-135457689 CACCGGGGATCGGGGCTGAGCGG + Exonic
1049020342 8:139952673-139952695 CGCCAGAGGATGGGGCCGAGGGG + Intronic
1049051478 8:140200367-140200389 GGCTGGAGGCAGGGGCTGGGAGG - Intronic
1049519403 8:143080473-143080495 AGCCCGAGGCCGGGGAGGAGGGG - Exonic
1049592045 8:143466993-143467015 AGCCAGCGGCCAGGGCTGAGAGG + Intronic
1049761468 8:144333766-144333788 CGCCGGAGGCGGGGGCGGGGCGG - Exonic
1049989318 9:976926-976948 CGCTGGACGGCGGGGCTGCGAGG - Intergenic
1050094221 9:2047228-2047250 GGCCCGGGGCCGGAGCTGAGCGG + Exonic
1050377204 9:4985386-4985408 CGCCGCAAGCCCGGGCCGAGGGG - Exonic
1051711362 9:19934428-19934450 CGCGGGAGCCCGGGGGTGCGCGG - Intergenic
1051936344 9:22447145-22447167 CGCCGGGGACGGGGGCGGAGGGG - Exonic
1053157542 9:35791520-35791542 CGCCGGAGGGTGGGGCCGGGAGG + Intergenic
1056592514 9:87974762-87974784 CGCCGGGGGCGGGGGCAGATAGG - Intergenic
1056935457 9:90912370-90912392 TGCCAGAGGCCGGGGTTGATGGG + Intergenic
1057733663 9:97633454-97633476 CCCCGGAGGACCGGCCTGAGCGG + Exonic
1060106480 9:120876452-120876474 GGACGGAGGCGGGGGCTGGGGGG - Intronic
1060822902 9:126671810-126671832 CGCTGGGGGCCTGGGCTGTGGGG - Intronic
1061713764 9:132505714-132505736 CTCCTGGGGCTGGGGCTGAGGGG + Intronic
1061841206 9:133359514-133359536 TCCCGGAGGGCGGGGCTCAGTGG - Intronic
1061866660 9:133494851-133494873 CAGGGGAGGCCGGGGCTGGGTGG - Intergenic
1061883006 9:133577359-133577381 CCCGGGGGGCCGGGGCTGCGAGG + Intergenic
1062265048 9:135683193-135683215 CGCAGAAGGCCTGGGCTCAGAGG - Intergenic
1062277147 9:135736498-135736520 GGCCGGGTGCCGGGGCTGGGGGG - Intronic
1062362325 9:136193787-136193809 GGCCGGAGGCCGGGGCGGGGTGG + Intergenic
1062495240 9:136828393-136828415 CGCTGGAGCTGGGGGCTGAGTGG + Intronic
1062518466 9:136947537-136947559 GGCCGCAGGCAGGGCCTGAGAGG - Intronic
1186593254 X:10953386-10953408 GGCCGGAGGCCCTGGCTGGGAGG - Intergenic
1187450949 X:19395657-19395679 GGCCAGAGGCTGGGGCTGGGTGG - Intronic
1190063393 X:47224711-47224733 CGACGGAGGCGGCGGCTGAGGGG - Exonic
1192481886 X:71492867-71492889 CGCGGGACGCCGGGGCGGGGCGG + Intronic
1195099323 X:101539299-101539321 CGCTGGAGGCCGGGGGTGCGGGG + Intergenic
1196723933 X:118879020-118879042 GGCCTGAGGCTGGGGCTGGGCGG - Intergenic
1199736920 X:150693688-150693710 CGCGGGAGGCCGGGGCAGCCCGG - Intronic
1200256377 X:154585212-154585234 GGCCGAAGGCCGGGGCACAGGGG + Exonic
1200261392 X:154619191-154619213 GGCCGAAGGCCGGGGCACAGGGG - Exonic
1200267375 X:154653488-154653510 GGCCGAAGGCCGGGGCACAGGGG - Exonic
1200310379 X:155071409-155071431 CGCCGAAGGCCAGGCCTGGGCGG + Intronic