ID: 1039889306

View in Genome Browser
Species Human (GRCh38)
Location 8:41673457-41673479
Sequence ACCCATAGACCTCACTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039889299_1039889306 16 Left 1039889299 8:41673418-41673440 CCAGGCTGCCCTTGAGGGGCCTA 0: 1
1: 1
2: 1
3: 11
4: 172
Right 1039889306 8:41673457-41673479 ACCCATAGACCTCACTGTGGTGG No data
1039889295_1039889306 29 Left 1039889295 8:41673405-41673427 CCAGGGGTAGTAACCAGGCTGCC 0: 1
1: 0
2: 1
3: 4
4: 103
Right 1039889306 8:41673457-41673479 ACCCATAGACCTCACTGTGGTGG No data
1039889302_1039889306 8 Left 1039889302 8:41673426-41673448 CCCTTGAGGGGCCTATCAGGGTA 0: 1
1: 0
2: 0
3: 4
4: 68
Right 1039889306 8:41673457-41673479 ACCCATAGACCTCACTGTGGTGG No data
1039889303_1039889306 7 Left 1039889303 8:41673427-41673449 CCTTGAGGGGCCTATCAGGGTAC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1039889306 8:41673457-41673479 ACCCATAGACCTCACTGTGGTGG No data
1039889304_1039889306 -3 Left 1039889304 8:41673437-41673459 CCTATCAGGGTACACTAAACACC 0: 1
1: 0
2: 1
3: 9
4: 61
Right 1039889306 8:41673457-41673479 ACCCATAGACCTCACTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039889306 Original CRISPR ACCCATAGACCTCACTGTGG TGG Intronic
No off target data available for this crispr