ID: 1039891026

View in Genome Browser
Species Human (GRCh38)
Location 8:41685521-41685543
Sequence TGTCCTCTCAGGACACAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039891026_1039891029 -6 Left 1039891026 8:41685521-41685543 CCAGACTGTGTCCTGAGAGGACA 0: 1
1: 0
2: 1
3: 18
4: 209
Right 1039891029 8:41685538-41685560 AGGACAATACTCATTTGCTTGGG No data
1039891026_1039891028 -7 Left 1039891026 8:41685521-41685543 CCAGACTGTGTCCTGAGAGGACA 0: 1
1: 0
2: 1
3: 18
4: 209
Right 1039891028 8:41685537-41685559 GAGGACAATACTCATTTGCTTGG No data
1039891026_1039891030 6 Left 1039891026 8:41685521-41685543 CCAGACTGTGTCCTGAGAGGACA 0: 1
1: 0
2: 1
3: 18
4: 209
Right 1039891030 8:41685550-41685572 ATTTGCTTGGGAAATTCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039891026 Original CRISPR TGTCCTCTCAGGACACAGTC TGG (reversed) Intronic
900542635 1:3211721-3211743 TCTCCTCTGAGGACCCAGGCCGG - Intronic
900621507 1:3589620-3589642 TGTCCTTGCAGGAGACACTCAGG - Intronic
900640800 1:3687273-3687295 TGCCCTCTCAGGACCCTGGCTGG + Intronic
902873734 1:19328845-19328867 GGGCCTCTCAGGAGACAGTGAGG + Exonic
905121328 1:35684306-35684328 TGTCCTCTGAGGTCACACCCAGG + Intergenic
908356380 1:63327930-63327952 GTTCCTCCCAGGACACAGGCGGG - Intergenic
908518738 1:64919874-64919896 GATCCTCTCAGGACAGAGTCGGG + Intronic
912226883 1:107744059-107744081 GGTCCTCTCAGGGCTCATTCTGG + Intronic
913030395 1:114897050-114897072 TGTCCTCCCAGTGCACAGGCTGG + Intronic
914878662 1:151530793-151530815 TGTCCTCTCAGGCCAGCTTCTGG - Intronic
917185848 1:172354445-172354467 TGTCCTCTCAGTGCTCAGGCTGG + Intronic
917209400 1:172616220-172616242 TGTTCTCTCAGTGCACAGGCTGG - Intergenic
917539650 1:175900353-175900375 TGTCCTCCCAGGACTTAGGCAGG + Intergenic
918207895 1:182325621-182325643 CATCCTCACACGACACAGTCAGG - Intergenic
918365388 1:183802840-183802862 TATCCTCTCAGGACTCTGTTAGG + Intronic
919597497 1:199581739-199581761 TGTTCTCTCAGGTCAGAATCTGG + Intergenic
920741747 1:208587358-208587380 TCTCTCCTCAGGACAGAGTCTGG + Intergenic
921914629 1:220593749-220593771 AGTCCCCTCAGAACACATTCAGG - Intronic
923729076 1:236533148-236533170 TCTTCTCTCAGCACGCAGTCAGG - Intronic
924321871 1:242858884-242858906 TGTCCCCAGAGGAAACAGTCAGG + Intergenic
1065489702 10:26270415-26270437 TGTTCTTTTAAGACACAGTCAGG + Intronic
1065637398 10:27745431-27745453 TGACCTCCCCGGCCACAGTCTGG - Intronic
1067167290 10:43875494-43875516 TGTCATCTCAGTGCACAGTAAGG + Intergenic
1070502661 10:77086406-77086428 TGTCCCCTCAGCACAGAGTCAGG + Intronic
1071868226 10:89762111-89762133 TGTCCTCTTAGAACACTTTCAGG - Intronic
1073833628 10:107415517-107415539 TGTCCTCCCAGTACACAGGTGGG + Intergenic
1074780771 10:116800441-116800463 CCTGCTCTCAGGACACAGTGGGG - Intergenic
1075283809 10:121165421-121165443 ACTACTCTCAGGAGACAGTCAGG + Intergenic
1076407147 10:130220230-130220252 TGGCCTCTCAGGCCTCAGGCTGG - Intergenic
1076776230 10:132699635-132699657 TGGCCTCTCAGGACACACCTCGG - Intronic
1076834887 10:133016078-133016100 TGACCTCTGAGCACACAGGCCGG + Intergenic
1076851889 10:133097313-133097335 TGTCCACTCAGGCCTCCGTCAGG + Intronic
1077474105 11:2778365-2778387 CCTCCACTCAGGACACAGCCAGG - Intronic
1081589192 11:44409238-44409260 TGTCCTCTCAGGCCAAAGCTGGG - Intergenic
1083146878 11:60766596-60766618 TGTCCTCACAGGGCACAGCATGG - Intronic
1083602009 11:63954593-63954615 TGTGCTCTCAGGGCGCAGCCTGG - Exonic
1084148413 11:67277051-67277073 TGGCCTTTGAGGACACAGCCTGG + Intronic
1085465830 11:76722590-76722612 TGTACTCTGGGGACACAGGCAGG - Intergenic
1086978188 11:93161985-93162007 AGTCCTTTCAGAACACAGTTGGG - Intronic
1087137044 11:94731444-94731466 GGTCCTCAGAGGACAGAGTCAGG + Intronic
1088345291 11:108817222-108817244 AGGCCTCACAGGACAGAGTCAGG - Intronic
1090706121 11:129338658-129338680 TGTTCTCCCAGTACACAGGCCGG - Intergenic
1090851518 11:130574930-130574952 TGTCCTCCCAGGCTTCAGTCTGG + Intergenic
1091368422 11:135040180-135040202 TGCCGACTCAGGACACACTCAGG - Intergenic
1091368457 11:135040356-135040378 TGCCGACTCAGGACACACTCAGG - Intergenic
1091368490 11:135040532-135040554 TGCCGACTCAGGACACACTCAGG - Intergenic
1091368525 11:135040708-135040730 TGCCGACTCAGGACACACTCAGG - Intergenic
1091368554 11:135040851-135040873 TGCCGACTCAGGACACACTCAGG - Intergenic
1091368581 11:135040994-135041016 TGCCGACTCAGGACACACTCAGG - Intergenic
1091368609 11:135041137-135041159 TGCCGACTCAGGACACACTCAGG - Intergenic
1091368636 11:135041280-135041302 TGCCGACTCAGGACACACTCAGG - Intergenic
1091368664 11:135041423-135041445 TGCCGACTCAGGACACACTCAGG - Intergenic
1091368679 11:135041500-135041522 TGCCGACTCAGGACACACTCAGG - Intergenic
1091368745 11:135041841-135041863 TGCCGACTCAGGACACACTCAGG - Intergenic
1091368766 11:135041951-135041973 TGCCGACTCAGGACACACTCAGG - Intergenic
1091368788 11:135042061-135042083 TGCCGACTCAGGACACACTCAGG - Intergenic
1091368802 11:135042138-135042160 TGCCAACTCAGGACACACTCAGG - Intergenic
1091368818 11:135042215-135042237 TGCCGGCTCAGGACACACTCAGG - Intergenic
1091368827 11:135042259-135042281 TGCCAACTCAGGACACACTCAGG - Intergenic
1091368857 11:135042402-135042424 TGCCGACTCAGGACACACTCAGG - Intergenic
1091368879 11:135042512-135042534 TGCCGACTCAGGACACACTCAGG - Intergenic
1091368893 11:135042589-135042611 TGCCAACTCAGGACACACTCAGG - Intergenic
1091368909 11:135042666-135042688 TGCCGGCTCAGGACACACTCAGG - Intergenic
1092623867 12:10304210-10304232 TTTCCCCTTAGGACACACTCTGG + Intergenic
1094433046 12:30390575-30390597 TTACCTATCAGGACAAAGTCTGG + Intergenic
1095938465 12:47710190-47710212 GATCCTCTCAGAACAGAGTCTGG - Exonic
1098239771 12:68455366-68455388 TTTCCTTTCAGGACACTGTGGGG - Intergenic
1098999867 12:77167010-77167032 TGTACACTCAGTACCCAGTCTGG + Intergenic
1100405938 12:94272897-94272919 TGCCCTCCCAGGAGACAGGCTGG - Intronic
1102809671 12:115813432-115813454 TGTCGTCTTAAGTCACAGTCTGG + Intergenic
1103536851 12:121639133-121639155 TGCCCTCCCAGGGCACACTCAGG - Intronic
1106903207 13:34376792-34376814 TGTGCTCCAAGGACACAGTCTGG + Intergenic
1107803298 13:44130872-44130894 TCTCCTCTGAGGCCACTGTCAGG - Intergenic
1113772304 13:112917927-112917949 AGTCCTTTCAGGACACCTTCAGG + Intronic
1114139812 14:19896630-19896652 TGTCCTGTGAGGATTCAGTCAGG - Intergenic
1115093510 14:29607025-29607047 TGTCAACTCATAACACAGTCAGG + Intronic
1117281624 14:54247056-54247078 TGACCTCTGAGGATAGAGTCTGG + Intergenic
1118591095 14:67401578-67401600 AGACCACTCAGGACACAGTGAGG + Intronic
1119156316 14:72415027-72415049 GGTTCTCTCAGCACGCAGTCTGG - Intronic
1120191289 14:81442185-81442207 TTTCCTCTCAGGAATAAGTCTGG - Intergenic
1121449699 14:93999242-93999264 TGCCATCTCAGGAGACAGGCCGG - Intergenic
1121587294 14:95070936-95070958 TTGCCCCTCAAGACACAGTCTGG - Intergenic
1121953194 14:98190220-98190242 TGTCCTGTCAGGACAGAGGTAGG + Intergenic
1121976979 14:98414003-98414025 TGTCCTCTCTGCACACAGATGGG + Intergenic
1132851066 16:2025296-2025318 TGGCCTCCCTGGACACAGCCTGG - Intergenic
1132890340 16:2200757-2200779 TCACCTCTCAGGACAGAGGCGGG + Intergenic
1133396376 16:5450653-5450675 TGTTCTCTGAGGTCAGAGTCAGG + Intergenic
1135287387 16:21205906-21205928 TGACATCTAAGGGCACAGTCAGG - Intronic
1137491297 16:48935290-48935312 TTTCCACTCAGGACAGAGGCAGG - Intergenic
1138023526 16:53504535-53504557 TGTCCCCTTAGGACACATTTAGG + Intergenic
1139914197 16:70418235-70418257 GGTCCTCTCTGGAAACAATCAGG + Intronic
1141762559 16:86038461-86038483 CTTCTGCTCAGGACACAGTCCGG - Intergenic
1141961391 16:87411710-87411732 TGCCCACTCAGGACAGGGTCTGG + Exonic
1143831659 17:9656943-9656965 TTTCCTCTCACGACACAGGATGG + Intronic
1145962578 17:28896273-28896295 TGTCTTCTCAGCTCAGAGTCTGG + Intronic
1147646750 17:42038850-42038872 TGTCCTCTCTGTACACAAGCTGG - Intronic
1147716683 17:42513379-42513401 AGTCTTCTCAGGACAGTGTCCGG + Intronic
1151403044 17:73868659-73868681 TGTACACTCAGGACTCAGTGGGG - Intergenic
1152865248 17:82718550-82718572 TGTCGTCTGAGGACACTGACAGG + Intronic
1153952432 18:10068685-10068707 CGCCATCACAGGACACAGTCAGG - Intergenic
1155181830 18:23354743-23354765 TGTCCTCTCAGTGCAGACTCTGG + Intronic
1157028784 18:43879484-43879506 TGTCTCCTCAGGAGACAGTCAGG + Intergenic
1157514464 18:48300998-48301020 TGCCCTCTGAGGACTCAGTAAGG + Intronic
1157683559 18:49625661-49625683 CGCCCTCTAAGGACACACTCTGG - Intergenic
1159589974 18:70323823-70323845 TGTCGTGCCAGGACACAGGCTGG + Intronic
1160217743 18:76947782-76947804 TGTCCACTCAGGATTCAGCCGGG - Intronic
1163726912 19:18928254-18928276 CGTCCACCCAGGACACCGTCTGG + Exonic
1165063744 19:33217615-33217637 CGTCCTCTCAGGACCCGGTCTGG - Intronic
1166320632 19:42016494-42016516 TGGCCCCTGAGGACACAGTGTGG + Intronic
925112433 2:1347567-1347589 TGTCCTGTCAGGCCCCTGTCTGG + Intronic
927469388 2:23361318-23361340 TGGCCTCTCATGGCAGAGTCTGG - Intergenic
927633262 2:24792938-24792960 TGTCCACTCTTCACACAGTCAGG + Intronic
929953885 2:46440470-46440492 AGTCTTCTCTGGACAAAGTCTGG - Intronic
932292613 2:70595092-70595114 TGTCCTCTCTTGACCCAGTGAGG - Intergenic
935071759 2:99700641-99700663 TGTTCCCTCAGGACACTTTCAGG - Intronic
936392863 2:112091347-112091369 TGTCCCTTCACAACACAGTCAGG + Intronic
936484467 2:112914456-112914478 CCTCTTCTCAGGACAGAGTCAGG + Intronic
937074304 2:119089829-119089851 TAGACTCTCAGCACACAGTCTGG + Intergenic
937334457 2:121052982-121053004 GGGCCTCTCAGGACACAGACAGG - Intergenic
938786822 2:134637355-134637377 TCTCATCTCAGGGCACACTCAGG - Intronic
939361971 2:141184272-141184294 TGTCCTCTGAGGACACCATAAGG - Intronic
940701233 2:157045451-157045473 TTTCTTCTCAGGATACAGTGTGG + Intergenic
941128201 2:161612579-161612601 TGTTCTAGCAGGGCACAGTCAGG + Intronic
942310163 2:174649086-174649108 TGTCATCTCAGGATACTGTGGGG - Intronic
943230998 2:185252126-185252148 TGTCATCTCATGACACTCTCAGG + Intergenic
946403064 2:219478953-219478975 TGTCCTCTGAGGGCACAGGTGGG - Intronic
949063627 2:241975669-241975691 TGTCCCATCAGGACACAGGAAGG + Intergenic
1168866136 20:1088439-1088461 TCTCCTTTAAGGATACAGTCAGG + Intergenic
1170293107 20:14793326-14793348 ACTCCTTTGAGGACACAGTCCGG - Intronic
1174473166 20:50776487-50776509 TCTCCTCTCTGGAGACTGTCAGG + Intergenic
1175503973 20:59469145-59469167 TGTCCTCCCTGGAGGCAGTCGGG + Intergenic
1175751419 20:61500601-61500623 TTTCCTCTCAAGACACAGAGAGG + Intronic
1175865823 20:62175906-62175928 TGTGCTCTCAGGACACTGTGAGG + Intronic
1176335053 21:5588787-5588809 TGTTCACTCAGGACATCGTCAGG - Intergenic
1176392704 21:6232161-6232183 TGTTCACTCAGGACATCGTCAGG + Intergenic
1176468715 21:7084013-7084035 TGTTCACTCAGGACATCGTCAGG - Intronic
1176492276 21:7465791-7465813 TGTTCACTCAGGACATCGTCAGG - Intergenic
1176508366 21:7672592-7672614 TGTTCACTCAGGACATCGTCAGG + Intergenic
1177287113 21:19065455-19065477 TGTCCGCTCAGGACTCACTCAGG - Intergenic
1179164541 21:38925288-38925310 TGTCTTCTGAGGACACTCTCTGG + Intergenic
1179189340 21:39109397-39109419 TGTCCACCCTGGACACAGTCGGG - Intergenic
1179982982 21:44906020-44906042 TGACCTCCCAGGCCACAGTGAGG - Intronic
1180167476 21:46037484-46037506 TGTCCTCTGAGCACACACTTTGG - Intergenic
1182458361 22:30467174-30467196 GTTCCTCTGAGGACAGAGTCGGG - Intronic
1184778291 22:46634012-46634034 TGTGCTCTCAGCAGACAGTTGGG + Intronic
1185035944 22:48476989-48477011 TCTCCACTCAGGGCACAGTGGGG - Intergenic
949709319 3:6856169-6856191 TCTTCTCTCAGTACACAGGCAGG - Intronic
952222032 3:31332639-31332661 TGGCATCTCTGGACACAGCCAGG + Intergenic
953427744 3:42809462-42809484 TCTCCTTTCAGGATACAGTACGG + Exonic
954794813 3:53156087-53156109 TGTCCCTTGAGGACACAATCGGG - Intronic
959633684 3:108537258-108537280 TGTCCTCTCAGGAGAGTGTGTGG - Intergenic
959650562 3:108746488-108746510 GGACCTCTCAGGACACAAACTGG - Intronic
959973923 3:112437202-112437224 TGTCCCCCCAGGAAACACTCAGG + Intergenic
960193230 3:114732457-114732479 TTTCCTCTACGGGCACAGTCAGG - Intronic
961117313 3:124341712-124341734 TGTACTCCCAGGACAGAGTGTGG - Intronic
961670245 3:128523567-128523589 TGTCCTCTCAGAGGACAGTGGGG + Intergenic
962352213 3:134664341-134664363 TGTGCCCTCAGCACACAGCCAGG + Intronic
962445753 3:135462625-135462647 TGTCCTCAGAGGACTCAGTATGG + Intergenic
964412221 3:156409528-156409550 TGTCCTCTCATGATACAGCAAGG - Intronic
966182828 3:177202626-177202648 TTTCCTTTCAGGACACATCCTGG + Intergenic
966881136 3:184351959-184351981 TAGGCTCTCAGGACACAGTGGGG - Intronic
968576959 4:1371365-1371387 TGTGGTCTCAGGACACAGTCTGG + Intronic
970294173 4:14610646-14610668 TGTCCTCCCAGGACATCATCTGG + Intergenic
972370767 4:38421143-38421165 TGTCCTCACATGACCCAGTGGGG + Intergenic
975512671 4:75210953-75210975 TTTCCTCAGAGGACAGAGTCTGG - Intergenic
976283852 4:83351840-83351862 TGTCCTCTCAGGAGAGAATGAGG + Intergenic
976930443 4:90560391-90560413 TGTCCTGTCAATACTCAGTCTGG + Intronic
978147682 4:105395317-105395339 TGTGCTCTCTGAGCACAGTCTGG - Intronic
980770184 4:137361885-137361907 TCTCCTCTCTGGACACAGTGTGG + Intergenic
982211306 4:153038893-153038915 TTTCCGCTCAGGAAACAGACAGG - Intergenic
986389881 5:7274822-7274844 TATCCTCTCAGGTCACCTTCTGG - Intergenic
986502119 5:8411735-8411757 TGTCCTCACATGACATAGGCAGG + Intergenic
986756279 5:10839591-10839613 TGACATCTCTGGACACACTCTGG + Intergenic
990020117 5:51116403-51116425 TGTCCACTCAGGAGACCTTCAGG + Intergenic
993634898 5:90331768-90331790 TGCCCTCTCAGGTCACAAGCTGG - Intergenic
996629112 5:125606522-125606544 TGTCCTCGAATGTCACAGTCCGG + Intergenic
998641175 5:144013036-144013058 TGTTCTCCCAGGACACAGGTGGG + Intergenic
998922118 5:147081283-147081305 CGTCCTCTCAGGACTCACTAGGG - Intronic
1001988167 5:176093684-176093706 TGTGCTCACAGGACACAGCATGG + Intronic
1001989118 5:176101496-176101518 TGTGCACACAGGACACAGCCTGG + Intronic
1001989376 5:176103696-176103718 TGTGCTCACAGGACACAGCATGG + Intronic
1002154947 5:177269909-177269931 TGTCCTCTCAGGGCATTATCTGG + Intronic
1002227497 5:177734442-177734464 TGTGCTCACAGGACACAGCATGG - Intronic
1002227752 5:177736642-177736664 TGTGCACACAGGACACAGCCTGG - Intronic
1002228701 5:177744456-177744478 TGTGCTCACAGGACACAGCATGG - Intronic
1002266645 5:178039327-178039349 TGTGCTCACAGGACACAGCATGG + Intronic
1002706151 5:181161834-181161856 ACTCGTCTCAGGACAGAGTCTGG - Intergenic
1007352014 6:41280885-41280907 CATCCTCTCAGCACACAGACTGG + Intronic
1007813066 6:44500022-44500044 TGTCCTCTCTGCACACATTCAGG + Intergenic
1010739316 6:79481239-79481261 TCTGCTTTCAGAACACAGTCTGG + Intergenic
1013212895 6:108002496-108002518 TGTTCTCCCAGGTCAAAGTCCGG - Intergenic
1013586342 6:111582303-111582325 GGTCCTGCCAGGAGACAGTCTGG - Intronic
1016876577 6:148871199-148871221 TGTCATGTGAGGACACAGGCAGG + Intronic
1018172040 6:161151272-161151294 TGTCCTCACAGGACTCAGGAAGG - Intronic
1018289970 6:162282094-162282116 GGTCCTCACAGGCCACAGACAGG + Intronic
1018721219 6:166574015-166574037 GGTCCACTCAAGACACACTCAGG + Intronic
1022518670 7:30991809-30991831 TGACTTCTCAGCACCCAGTCTGG + Intronic
1022619904 7:31972394-31972416 TGTTTTCTCAGGATAAAGTCAGG - Intronic
1023790022 7:43746528-43746550 TGTCCTCACAGGACCCTGTGAGG - Intergenic
1024562495 7:50656148-50656170 TCCCCTACCAGGACACAGTCAGG - Intronic
1024619730 7:51147083-51147105 TTTCCTCTCAGAATCCAGTCAGG + Intronic
1025117527 7:56270994-56271016 TGTCCTCAGAGGACAGAGTCTGG - Intergenic
1026201414 7:68217897-68217919 TGTCCTCAGAGGACAGAGTCTGG - Intergenic
1026734080 7:72938004-72938026 TATCCTCTCCGTAGACAGTCTGG + Intronic
1032534138 7:132646552-132646574 TGCCCTGTGAGGACACAGTGAGG + Intronic
1033430315 7:141283134-141283156 TATGCTCTTAGGACACAGCCAGG - Intronic
1033537113 7:142322223-142322245 TGACTCCTCAGGCCACAGTCAGG + Intergenic
1037898049 8:22671343-22671365 TGTCCTCCCAGGAGTCTGTCTGG + Intergenic
1039891026 8:41685521-41685543 TGTCCTCTCAGGACACAGTCTGG - Intronic
1039989313 8:42474827-42474849 TGTGCTCTCACGACACTGTGTGG - Intronic
1043187318 8:77170416-77170438 TTTCCTAACAGGACACAGACTGG + Intergenic
1046855961 8:119032383-119032405 TGTCCTCTCAGTACACTGTGTGG - Intronic
1048822494 8:138392868-138392890 AGTATTCTCAGAACACAGTCTGG - Intronic
1049415543 8:142493247-142493269 TGTCCTCTTCGGCCACAGTTGGG - Intronic
1049488278 8:142877604-142877626 TCTCCCCTCAGGACACTGTGTGG - Intronic
1049493167 8:142915628-142915650 TCTCCCCTCAGGACACTGTGTGG - Intronic
1055748019 9:79472105-79472127 TGGCCTCTCAGCAGACAGTGAGG - Intergenic
1056033971 9:82584347-82584369 TCTGCTCTCAGGCCACAGGCAGG + Intergenic
1059450833 9:114370586-114370608 TGGTCTCTCTGGACACAGCCAGG + Intronic
1059901766 9:118935407-118935429 TGCCCTCTCATGACACTTTCAGG - Intergenic
1060429705 9:123540112-123540134 TGTCCTATGAGGAAACAGTTGGG - Intronic
1062022818 9:134327139-134327161 TGTCCGCCCAGGAAACAGACTGG + Intronic
1203426588 Un_GL000195v1:46129-46151 TGTTCTCTCAGGACATCGTCAGG + Intergenic
1186623441 X:11265952-11265974 TGTCCTTTCAGAACAGAGGCAGG + Intronic
1189336678 X:40174728-40174750 TGTCTTCTTAGGACACAGACTGG + Intronic
1189527529 X:41840512-41840534 TGTCATCTCAGAACAAAGACAGG + Intronic
1194126812 X:90028779-90028801 TGTCATGTTAGGACACAGTTTGG + Intergenic
1195689317 X:107610832-107610854 TGTCCTCAGTGGACACAGTCTGG + Intergenic
1195719595 X:107853602-107853624 TGTCCTCTCTTGATACAGTCAGG + Intronic