ID: 1039892910

View in Genome Browser
Species Human (GRCh38)
Location 8:41696717-41696739
Sequence GGTCTCGGTGGCCGGGCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 199}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039892893_1039892910 29 Left 1039892893 8:41696665-41696687 CCGCCACTCACCCTGTATGCACC 0: 1
1: 0
2: 2
3: 21
4: 209
Right 1039892910 8:41696717-41696739 GGTCTCGGTGGCCGGGCTGCTGG 0: 1
1: 0
2: 0
3: 23
4: 199
1039892903_1039892910 -1 Left 1039892903 8:41696695-41696717 CCACCGGGCTGATGTTGTCTGAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1039892910 8:41696717-41696739 GGTCTCGGTGGCCGGGCTGCTGG 0: 1
1: 0
2: 0
3: 23
4: 199
1039892902_1039892910 8 Left 1039892902 8:41696686-41696708 CCGGGCTGGCCACCGGGCTGATG 0: 1
1: 0
2: 3
3: 17
4: 221
Right 1039892910 8:41696717-41696739 GGTCTCGGTGGCCGGGCTGCTGG 0: 1
1: 0
2: 0
3: 23
4: 199
1039892905_1039892910 -4 Left 1039892905 8:41696698-41696720 CCGGGCTGATGTTGTCTGAGGTC 0: 1
1: 0
2: 1
3: 15
4: 373
Right 1039892910 8:41696717-41696739 GGTCTCGGTGGCCGGGCTGCTGG 0: 1
1: 0
2: 0
3: 23
4: 199
1039892895_1039892910 26 Left 1039892895 8:41696668-41696690 CCACTCACCCTGTATGCACCGGG 0: 1
1: 0
2: 0
3: 7
4: 67
Right 1039892910 8:41696717-41696739 GGTCTCGGTGGCCGGGCTGCTGG 0: 1
1: 0
2: 0
3: 23
4: 199
1039892892_1039892910 30 Left 1039892892 8:41696664-41696686 CCCGCCACTCACCCTGTATGCAC 0: 1
1: 0
2: 0
3: 10
4: 204
Right 1039892910 8:41696717-41696739 GGTCTCGGTGGCCGGGCTGCTGG 0: 1
1: 0
2: 0
3: 23
4: 199
1039892899_1039892910 18 Left 1039892899 8:41696676-41696698 CCTGTATGCACCGGGCTGGCCAC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1039892910 8:41696717-41696739 GGTCTCGGTGGCCGGGCTGCTGG 0: 1
1: 0
2: 0
3: 23
4: 199
1039892898_1039892910 19 Left 1039892898 8:41696675-41696697 CCCTGTATGCACCGGGCTGGCCA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1039892910 8:41696717-41696739 GGTCTCGGTGGCCGGGCTGCTGG 0: 1
1: 0
2: 0
3: 23
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039892910 Original CRISPR GGTCTCGGTGGCCGGGCTGC TGG Exonic