ID: 1039893293

View in Genome Browser
Species Human (GRCh38)
Location 8:41698765-41698787
Sequence TCACATTAGAAACTATTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039893293_1039893295 10 Left 1039893293 8:41698765-41698787 CCTGGCAATAGTTTCTAATGTGA 0: 1
1: 0
2: 2
3: 17
4: 127
Right 1039893295 8:41698798-41698820 ACAATTTTTTTTTTTTGAGATGG 0: 64
1: 854
2: 4853
3: 22654
4: 135644

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039893293 Original CRISPR TCACATTAGAAACTATTGCC AGG (reversed) Intronic
901253094 1:7796613-7796635 TCATATTGGAAACTGTTTCCGGG - Intronic
903570030 1:24297568-24297590 TCACATAAGCAACTACTGTCTGG - Intergenic
904634520 1:31869531-31869553 TCACATGAGACACTGTTGGCTGG - Intergenic
905851139 1:41275976-41275998 TCACATTCGAAAATATGGCCGGG - Intergenic
909231340 1:73093999-73094021 TCACAGTGGAAAGTAATGCCAGG - Intergenic
910763666 1:90759426-90759448 ACACAGTAGAAACAATTTCCTGG - Intergenic
911974253 1:104471632-104471654 TAAAATTAGAAACTTTTGTCTGG + Intergenic
915767272 1:158375163-158375185 TCACATTATAAATTATTTTCTGG - Intergenic
916839141 1:168581999-168582021 TCACATGAGGAAATATTGCATGG - Exonic
1065325001 10:24543029-24543051 AGACAGTAGAAACTATTCCCAGG + Exonic
1067071595 10:43136862-43136884 TCAGATTGGAAATTATTGGCAGG + Intergenic
1070190560 10:74108213-74108235 TCACATAAGAAGCCATTCCCAGG - Intronic
1070446439 10:76509211-76509233 TGACATTAGAAATTATTGCCAGG - Intronic
1070763353 10:79040105-79040127 TAACAATAGAAATTATTGGCTGG + Intergenic
1070989524 10:80719206-80719228 TCCCATTAGACACTATTGCCTGG + Intergenic
1072936251 10:99716483-99716505 TCACATTAGATAGAAGTGCCAGG + Intronic
1073638376 10:105222558-105222580 TCAAACTAGAAACAAATGCCAGG - Intronic
1073894476 10:108138969-108138991 GCACATCAGAAAATTTTGCCTGG - Intergenic
1078672661 11:13378510-13378532 TGACATTGCAAAATATTGCCTGG - Intronic
1080131315 11:28798210-28798232 CCACTTTAGAAATTATTTCCAGG + Intergenic
1085955581 11:81389715-81389737 TCTCATTAGATACTATGACCTGG - Intergenic
1086197090 11:84153839-84153861 TCTCATTAGGAACTATTGTTGGG + Intronic
1087639052 11:100735805-100735827 TCACTGTTGAAACTATGGCCAGG + Intronic
1089922850 11:122227273-122227295 TCACATTAAAAATATTTGCCTGG + Intergenic
1091246613 11:134101511-134101533 TCACAATAGAAACTTAAGCCTGG - Intronic
1092248146 12:6874979-6875001 TCACATTAGTATCTATTGCATGG + Intronic
1093341601 12:17982003-17982025 TCATATTCCAAACAATTGCCAGG - Intergenic
1094531417 12:31278897-31278919 CCTCATTGGAAACTATTCCCTGG - Intergenic
1096932580 12:55229739-55229761 TCTCATTAGATACTTTAGCCTGG - Intergenic
1097253400 12:57653248-57653270 TCAAATTATAAATTATGGCCAGG + Intergenic
1099573859 12:84357790-84357812 TGACATTACAAACCATGGCCAGG + Intergenic
1108847736 13:54696727-54696749 TCACTTTAGAAAGGACTGCCTGG - Intergenic
1108971758 13:56384674-56384696 TCACATTAGAAAATATTTCTGGG - Intergenic
1109019066 13:57061769-57061791 TAAAATTAGAAAAAATTGCCAGG - Intergenic
1112907313 13:104440362-104440384 TGAAATGAGAAACTATAGCCAGG - Intergenic
1113033464 13:106020728-106020750 TTCCATTTGAAAGTATTGCCTGG + Intergenic
1113802543 13:113094095-113094117 TCACTTTAGAAACTGCTTCCCGG + Intronic
1114928085 14:27430758-27430780 CCTCGTTAGAAACTATTGCCAGG + Intergenic
1117589117 14:57247092-57247114 TGACATTTGAAAATATAGCCAGG + Intronic
1119590674 14:75884647-75884669 GCAAATTGGAAACTATTTCCTGG - Intronic
1202829466 14_GL000009v2_random:11111-11133 TCACATCAGATAATATTGCCCGG + Intergenic
1124901419 15:33826606-33826628 TTACATTAGAAAGTATTCTCTGG + Intronic
1125088981 15:35768624-35768646 TGAAATTAAAAACTACTGCCAGG - Intergenic
1127828103 15:62723843-62723865 GCATATTAAAAAATATTGCCGGG - Intronic
1130288879 15:82579159-82579181 TGTCATTAAAAACTATTTCCAGG + Intronic
1131171601 15:90182957-90182979 TAACATTAAAAATTCTTGCCGGG - Intronic
1132438967 15:101839923-101839945 TCAAACTACAAACTATTGCAAGG - Intergenic
1134219322 16:12341170-12341192 ACTCATTAGAAAGTACTGCCTGG + Intronic
1140799962 16:78477585-78477607 TCACATTAGAAATTCTCCCCTGG - Intronic
1147231779 17:39024795-39024817 TCACATTAGAAGCAAGGGCCAGG - Intergenic
1151400472 17:73852664-73852686 TCTCATTAGAAGCTATTTGCAGG - Intergenic
1152052664 17:77993894-77993916 TCATTATAGAAACTATTGGCTGG + Intergenic
1154418151 18:14197123-14197145 TCACATGAGATAATACTGCCCGG + Intergenic
1155669058 18:28347415-28347437 TCAGATTTGAAACTAGTGCAGGG - Intergenic
1158615172 18:58980471-58980493 TCACATTAGAGACACTTGCAGGG - Intronic
1164097925 19:22028566-22028588 TGACAATAGTAACTATTGTCTGG + Intergenic
1164870245 19:31637329-31637351 TCATATAAGAAAATATTGGCCGG - Intergenic
1166249274 19:41555945-41555967 TCACAGTACAAAGTAATGCCTGG + Intronic
1167480972 19:49731084-49731106 TCATATTAGAAACTTGTGCTGGG - Intergenic
1167780695 19:51597047-51597069 TCACTTTAGTAACTACTGGCTGG - Intergenic
927453810 2:23232119-23232141 TCATCTTGCAAACTATTGCCTGG + Intergenic
929715764 2:44307880-44307902 TTATATTAGAAACCATTGCCTGG + Intronic
930614858 2:53583041-53583063 TCACATTAGAAATCATTCCTGGG + Intronic
931970174 2:67577235-67577257 TTAAATTTAAAACTATTGCCTGG + Intergenic
933711454 2:85328938-85328960 TCACTTTATCAACGATTGCCAGG + Intergenic
935415449 2:102812157-102812179 TCAAATTTGTAACTATTTCCTGG + Intronic
939253443 2:139713567-139713589 TTACATAAGAAAGTATTGGCCGG + Intergenic
939526536 2:143302374-143302396 TCACATAAAAAACTATAGCAAGG + Intronic
944506148 2:200413530-200413552 ACAAAATAGAAACTAATGCCAGG - Intronic
945448715 2:209969041-209969063 TAAGCTTAGAAAGTATTGCCAGG + Intronic
946368215 2:219263900-219263922 TCACATTAGCAACTACTTCCTGG + Intronic
946885060 2:224214937-224214959 TCTCATTAAAAACTACTGCTTGG - Intergenic
947785985 2:232820618-232820640 TTACGTTAGAAATTATTGCTGGG - Intronic
1169882290 20:10360202-10360224 TCAGATTAGAAACTATTTTTAGG - Intergenic
1171890350 20:30706874-30706896 TCACATCAGATAATACTGCCCGG - Intergenic
1176608651 21:8855953-8855975 TCACATCAGATAATATTGCCCGG + Intergenic
1177807807 21:25891254-25891276 TCACATTATTTACTATTACCTGG + Intronic
1180358738 22:11865771-11865793 TCACATCAGATAATATTGCATGG + Intergenic
1183787204 22:40036684-40036706 TCACACTAGTGACTATAGCCTGG + Exonic
949687889 3:6598860-6598882 TAACATAAGAAGCTATTGACAGG + Intergenic
950266369 3:11576134-11576156 CCACGTTAGCAACTGTTGCCAGG + Intronic
958856738 3:99394534-99394556 TCACTTTATAATCTATTTCCTGG + Intergenic
960025417 3:113003377-113003399 TGAGATTAGAAACTATTGTCAGG - Exonic
961513061 3:127415015-127415037 TCATATAAGAAAATATGGCCGGG - Intergenic
961939893 3:130626064-130626086 AGAAGTTAGAAACTATTGCCAGG + Intronic
962299106 3:134221900-134221922 TCACTTAAGAATCTCTTGCCTGG - Intronic
963697734 3:148582784-148582806 TTACTTAAGAAACTATTGCTAGG + Intergenic
963719141 3:148839971-148839993 TCATAATAGAAACTATCACCTGG + Intronic
969852204 4:9967745-9967767 TTACATTAAAAAATCTTGCCTGG + Intronic
970504503 4:16713753-16713775 TAACATTAGAAAGAATTTCCAGG - Intronic
972726215 4:41748213-41748235 TCACGTTAGAAGCGATTGCAGGG - Intronic
972817555 4:42660756-42660778 TCAAATTAAAAACTTTTGTCTGG + Intergenic
973336719 4:48963935-48963957 TCACTGTAAAAAATATTGCCTGG - Intergenic
974080783 4:57210216-57210238 TCAGACTGGGAACTATTGCCAGG - Intergenic
976626339 4:87187354-87187376 TCAAATTGGCAACTATGGCCGGG - Intronic
978609883 4:110525978-110526000 TCAAAATAGAAACTATGGCCGGG + Intronic
978700351 4:111636312-111636334 TCACATTAAAAACTATAACTTGG + Intergenic
978935539 4:114370254-114370276 TCACTTGAGAAACTAGTGGCAGG - Intergenic
980794841 4:137667978-137668000 TCACATTTGAAAATATTGATTGG + Intergenic
986160371 5:5222232-5222254 TCACAATGGAACCTCTTGCCTGG + Intronic
988989807 5:36659340-36659362 TCAAATTAGAGCCTACTGCCAGG - Intronic
989430420 5:41348453-41348475 TGACATTGGAAAATATTACCAGG - Intronic
990791071 5:59480651-59480673 TCATATTGGAAAATAATGCCTGG - Intronic
992113076 5:73514409-73514431 TCAAATTAGAAACTGTAGACAGG - Intergenic
996421255 5:123265358-123265380 GCAGATTAGAAACTCTTTCCAGG - Intergenic
1000818801 5:165958070-165958092 TCCCATTAAAAAATATTTCCAGG + Intergenic
1004092385 6:12516901-12516923 TCATATTAGGAGCTATAGCCAGG - Intergenic
1008178452 6:48297847-48297869 TCACATTTGAAAATATGGCCAGG - Intergenic
1010327796 6:74585992-74586014 TCACATTAAAAAATCTTCCCTGG + Intergenic
1012470949 6:99571690-99571712 TCACAATAGAAAATATTGGCAGG + Intergenic
1012754890 6:103216166-103216188 TCACATGAAAAAATATTTCCTGG + Intergenic
1014834125 6:126139785-126139807 TCACATTAGAAAGTTTAGCAAGG - Intergenic
1015469152 6:133583770-133583792 CCACAATAGAAAGTATTGCAGGG + Intergenic
1021233688 7:18117056-18117078 CAACATTATAAACTATTTCCAGG + Intronic
1023893520 7:44412624-44412646 TTAAATTAGAAACCATTGGCAGG + Intronic
1027933026 7:84564327-84564349 CCAGACTAGAAACTTTTGCCTGG - Intergenic
1028294086 7:89105730-89105752 TGAGATCAGAAACTATTTCCAGG - Intronic
1028335668 7:89651513-89651535 TCAGTTTAGAAAATATAGCCTGG - Intergenic
1028806255 7:95029449-95029471 TAACATCATAAGCTATTGCCTGG - Intronic
1031199746 7:118665855-118665877 TCACATAAGTACCTATTGCCGGG - Intergenic
1031574787 7:123401698-123401720 TCACAATAGAAAATATTTTCTGG + Intergenic
1032273931 7:130438259-130438281 TCAAAATAGTAACTATTGGCAGG + Intronic
1032313931 7:130816256-130816278 TCACATGAAAGACTATTTCCAGG + Intergenic
1035219944 7:157400517-157400539 TCTCATTAGAAGCTCCTGCCAGG - Intronic
1036979673 8:13456314-13456336 TCACATATGAAACTATTGGCTGG - Intronic
1037197487 8:16208522-16208544 TCACAGTTTAAACTATTGCATGG + Intronic
1039227934 8:35410151-35410173 TCACATGAGCAACTATTGTCTGG + Intronic
1039893293 8:41698765-41698787 TCACATTAGAAACTATTGCCAGG - Intronic
1041117178 8:54551232-54551254 TCACATTGAAAACTTGTGCCTGG + Intergenic
1042250303 8:66749914-66749936 ACACCCTAGAAACTATTTCCAGG - Intronic
1043409042 8:79972942-79972964 CCAAATTAAAATCTATTGCCAGG + Intronic
1046814035 8:118564438-118564460 TGACATCAGAAACAATTGCTGGG + Intronic
1048118677 8:131554871-131554893 TCACAGCAGAAAGCATTGCCAGG + Intergenic
1049908820 9:245502-245524 TCAAAAAAGAAACTATTGGCCGG - Intronic
1050951199 9:11596615-11596637 TCACATTAGTAACAAATGCTTGG + Intergenic
1053332925 9:37232966-37232988 TCACATGAGACAGTATTCCCAGG + Intronic
1054358548 9:64089321-64089343 TCACATCAGATAATACTGCCCGG + Intergenic
1055050471 9:71975070-71975092 TGACATCAGAAAATATTACCTGG + Intronic
1062405081 9:136392405-136392427 TCACAGCAGAACCTGTTGCCAGG + Intronic
1203704051 Un_KI270742v1:21167-21189 TCACATCAGATAATATTGCCCGG + Intergenic
1185818032 X:3174398-3174420 ACACAGTGGATACTATTGCCTGG + Intergenic
1187665525 X:21604916-21604938 TCACATAAGAAATAAATGCCTGG - Intronic
1188814507 X:34694819-34694841 TCATATTAAAAACTACTGGCCGG - Intergenic
1195836469 X:109120329-109120351 ACACAATAGAAACAATTGCCTGG + Intergenic
1196365627 X:114920646-114920668 TCCCCTTAGAAACTACTCCCTGG + Intergenic
1197532202 X:127643260-127643282 TCACATTTGAAAATATACCCAGG + Intergenic
1198039853 X:132839819-132839841 TCAAATTAGAACCTCTGGCCGGG + Intronic