ID: 1039895355

View in Genome Browser
Species Human (GRCh38)
Location 8:41713212-41713234
Sequence TATCCTGTTTCCCGTGCGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039895351_1039895355 5 Left 1039895351 8:41713184-41713206 CCTGCCACATGACGGATCTCCCA No data
Right 1039895355 8:41713212-41713234 TATCCTGTTTCCCGTGCGCCTGG No data
1039895349_1039895355 27 Left 1039895349 8:41713162-41713184 CCTTCTCTGCAGCACTTGGATGC No data
Right 1039895355 8:41713212-41713234 TATCCTGTTTCCCGTGCGCCTGG No data
1039895352_1039895355 1 Left 1039895352 8:41713188-41713210 CCACATGACGGATCTCCCATAAA No data
Right 1039895355 8:41713212-41713234 TATCCTGTTTCCCGTGCGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039895355 Original CRISPR TATCCTGTTTCCCGTGCGCC TGG Intronic