ID: 1039896952

View in Genome Browser
Species Human (GRCh38)
Location 8:41723586-41723608
Sequence GATCACGTTGCCCCTGCGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039896946_1039896952 1 Left 1039896946 8:41723562-41723584 CCGATCCAGCAGCAGCCGCACCA 0: 1
1: 0
2: 2
3: 32
4: 367
Right 1039896952 8:41723586-41723608 GATCACGTTGCCCCTGCGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 49
1039896944_1039896952 3 Left 1039896944 8:41723560-41723582 CCCCGATCCAGCAGCAGCCGCAC 0: 1
1: 0
2: 1
3: 26
4: 215
Right 1039896952 8:41723586-41723608 GATCACGTTGCCCCTGCGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 49
1039896947_1039896952 -4 Left 1039896947 8:41723567-41723589 CCAGCAGCAGCCGCACCATGATC 0: 1
1: 0
2: 1
3: 30
4: 296
Right 1039896952 8:41723586-41723608 GATCACGTTGCCCCTGCGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 49
1039896945_1039896952 2 Left 1039896945 8:41723561-41723583 CCCGATCCAGCAGCAGCCGCACC 0: 1
1: 0
2: 7
3: 78
4: 565
Right 1039896952 8:41723586-41723608 GATCACGTTGCCCCTGCGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 49
1039896941_1039896952 29 Left 1039896941 8:41723534-41723556 CCTTGGTCTTGGTTTCTATCTGG 0: 1
1: 0
2: 2
3: 20
4: 185
Right 1039896952 8:41723586-41723608 GATCACGTTGCCCCTGCGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039896952 Original CRISPR GATCACGTTGCCCCTGCGGG AGG Exonic
912485400 1:110023445-110023467 CATCACGTTAGCCCTGCTGGAGG + Exonic
919898344 1:202024025-202024047 GATCACTTGGGCCCTGGGGGTGG - Intergenic
1079683897 11:23332183-23332205 GCCCACCTTGCCCCTGGGGGAGG + Intergenic
1079924461 11:26476623-26476645 GATCACTCTGCCCCTTTGGGTGG + Intronic
1083717586 11:64586776-64586798 GATCATGTTGCCACTTTGGGTGG - Intergenic
1084520422 11:69659274-69659296 CAGTAGGTTGCCCCTGCGGGCGG + Intronic
1098331615 12:69359706-69359728 GAGCCCGTTGCGCCTGCGCGCGG + Exonic
1101259598 12:103014577-103014599 GATCATGTTGGCCCTGCATGGGG + Intergenic
1103901765 12:124307112-124307134 GATCACGATGCCCCCGCGGATGG - Intronic
1105315372 13:19255154-19255176 GAACACGTTTCCACTGCTGGTGG + Intergenic
1105327309 13:19382326-19382348 GACCCCGCTGCCCCTGCGGAAGG - Intergenic
1202892268 14_KI270722v1_random:169666-169688 CATCACTTTGCCCATGCTGGGGG - Intergenic
1126823685 15:52528979-52529001 GATGGCGAGGCCCCTGCGGGCGG - Exonic
1137004005 16:35255630-35255652 GATCCCGCTGACCCCGCGGGTGG - Intergenic
1138396683 16:56709873-56709895 GACCAGGTTGGCCCTGCAGGCGG + Intronic
1142547582 17:715195-715217 GATCACGTCGCCCCCGTGGCCGG - Intronic
1148976076 17:51529975-51529997 GAGCACGTTTACCCTGCTGGTGG + Intergenic
1149922737 17:60674600-60674622 GAGCAGGTTGCCGCTGCTGGGGG + Intergenic
1151479660 17:74362520-74362542 GCTCAGCTTGCCCCTGGGGGAGG - Intergenic
1157244213 18:46039328-46039350 GATCATGATGCTCCTGGGGGTGG - Intronic
1160898757 19:1416167-1416189 GAGCACGTTGCTCCTGCTGCTGG + Intronic
1161349543 19:3784359-3784381 GACCACGTCGCCCTTGCGGAAGG + Exonic
947587037 2:231362685-231362707 GATGACGTTGCCAGTGAGGGAGG - Intronic
948362527 2:237433027-237433049 ATTCACTTTGCCCCTGAGGGAGG - Intergenic
948916906 2:241039109-241039131 GATCAGGGAGCCCCTGTGGGGGG - Intronic
1172590380 20:36113553-36113575 GAGCATGTTGCTCCTGGGGGTGG + Intronic
1176899220 21:14419608-14419630 CATCACTTTGCCACTGCCGGGGG - Intergenic
1179411850 21:41168347-41168369 CTTCACGCTGCCCCTCCGGGTGG + Exonic
1180011612 21:45055013-45055035 GCTCAGGGTGGCCCTGCGGGAGG + Intergenic
1184661819 22:45968995-45969017 GTTCAGGTTGCCCTTGGGGGAGG - Intronic
1185404744 22:50641448-50641470 GCTCAGGTTGCCCCTCGGGGAGG + Intergenic
960944858 3:122958804-122958826 GATGAAGTTGCCCCTGGGAGAGG - Intronic
961378741 3:126483456-126483478 GATCACCTCACCCCTGCAGGAGG + Exonic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
1002267392 5:178045015-178045037 GATCACGTAGCGCCTGTGTGGGG - Intronic
1002987930 6:2209408-2209430 GCTCACCTTCCCCCTGCAGGGGG + Intronic
1004273207 6:14212796-14212818 GCTCACCTCGCCCCTGTGGGGGG - Intergenic
1020096268 7:5371155-5371177 GATCACAGAGCCGCTGCGGGAGG - Exonic
1020114752 7:5470290-5470312 GGTCACGGGGCCCCTGAGGGTGG - Intronic
1021383760 7:20002714-20002736 GATCACCTTGCCCTTTCGGCCGG + Intergenic
1021640015 7:22727679-22727701 GTTCCCCTTGCCCCTGCGTGTGG + Intronic
1024640101 7:51321512-51321534 GATCAAGGTGCCACTGCGGTTGG - Intergenic
1039896952 8:41723586-41723608 GATCACGTTGCCCCTGCGGGAGG + Exonic
1039998884 8:42560022-42560044 GAGCAGGTTGCTCCTGCTGGTGG + Intergenic
1043224134 8:77701296-77701318 AAGCAGGTTGCCCCTGCTGGTGG - Intergenic
1058886302 9:109323691-109323713 CACCACGTTGCCCATGCTGGAGG + Intergenic
1059166808 9:112084805-112084827 GATCACATTGGCCCAGCGGGTGG - Intronic
1060445177 9:123680968-123680990 CACCAGGTTGCCCCTTCGGGAGG - Intronic
1062012066 9:134272735-134272757 GATGACCTGGGCCCTGCGGGGGG - Intergenic
1062212130 9:135370882-135370904 GATGAGGCTGCCCCTGCGGCCGG - Intergenic
1187025978 X:15435736-15435758 GATCCCATTGCCCCTGCATGGGG + Intronic
1192153250 X:68724752-68724774 GACCTCTTTGCCCCTGCAGGCGG - Exonic