ID: 1039897923

View in Genome Browser
Species Human (GRCh38)
Location 8:41729514-41729536
Sequence CGCCTTAGTCCCCACCTACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039897923_1039897930 24 Left 1039897923 8:41729514-41729536 CCAAGTAGGTGGGGACTAAGGCG 0: 1
1: 0
2: 1
3: 11
4: 261
Right 1039897930 8:41729561-41729583 TTAAATTTTTTTGTAGAGATGGG 0: 265
1: 1663
2: 6283
3: 19300
4: 54136
1039897923_1039897929 23 Left 1039897923 8:41729514-41729536 CCAAGTAGGTGGGGACTAAGGCG 0: 1
1: 0
2: 1
3: 11
4: 261
Right 1039897929 8:41729560-41729582 TTTAAATTTTTTTGTAGAGATGG 0: 352
1: 1707
2: 6297
3: 22119
4: 57788

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039897923 Original CRISPR CGCCTTAGTCCCCACCTACT TGG (reversed) Intronic
901016797 1:6236422-6236444 CGCCTTTAACCCCAGCTACTTGG + Intergenic
901395737 1:8980111-8980133 CGCCTGTGACCCCAGCTACTTGG - Intergenic
904136715 1:28318318-28318340 TGCCTGTGTCCCCAGCTACTTGG + Intergenic
904432107 1:30470932-30470954 CGCCTGAGGCCCCAGCTACTCGG + Intergenic
905188080 1:36211233-36211255 CGCCTGTGTTCCCAGCTACTAGG + Intergenic
905701047 1:40014673-40014695 CGCCTGTGGCCCCAGCTACTTGG - Intergenic
905746760 1:40424843-40424865 CGCCTTTGGCCCCAGCTACTTGG - Intergenic
905854590 1:41300210-41300232 CGCCTGTAGCCCCACCTACTTGG - Intergenic
906041815 1:42793530-42793552 CACCTTAGCCCCCATCTAGTAGG - Intronic
907768064 1:57430499-57430521 CGCCTGTGGTCCCACCTACTCGG - Intronic
908536571 1:65083975-65083997 CACCTGTGTCCCCAGCTACTTGG + Intergenic
909882524 1:80898193-80898215 CGCCTGTGGCCCCAGCTACTCGG - Intergenic
910142845 1:84045366-84045388 CGCCTGTGTTCCCAACTACTTGG - Intergenic
912647503 1:111407884-111407906 CTCCTTAGTCTCCTCCAACTTGG + Intergenic
914839836 1:151239396-151239418 CGCCTGTGGTCCCACCTACTCGG - Intronic
915349053 1:155213252-155213274 CGCCTTCGTCTTCAGCTACTTGG + Exonic
915352240 1:155233879-155233901 CGCCTTCGTCTTCAGCTACTTGG + Intergenic
916067698 1:161149837-161149859 CACCTGTGTCCCCATCTACTTGG - Intergenic
918378543 1:183932834-183932856 CCCATGAGTCCCCACCTCCTTGG + Intronic
919547348 1:198940392-198940414 CGCCTGTATCCCCAGCTACTCGG - Intergenic
921003185 1:211065931-211065953 ACCTGTAGTCCCCACCTACTTGG + Intronic
923349793 1:233092922-233092944 CGCCTGTGTACCCAGCTACTGGG - Intronic
923392967 1:233532090-233532112 CACCTGAAGCCCCACCTACTTGG - Intergenic
924511949 1:244735061-244735083 CGCCTGTATTCCCACCTACTTGG - Intergenic
1062827377 10:582455-582477 CGCCTGAGGTCCCAGCTACTTGG + Intronic
1064281989 10:13959344-13959366 TGCCTTTGGCCCCAGCTACTTGG + Intronic
1064621782 10:17224711-17224733 CGCCTTTGGTCCCAGCTACTGGG + Intergenic
1064743163 10:18453753-18453775 CGCCTGTGACCCCAGCTACTTGG - Intronic
1065218702 10:23474557-23474579 CGCCTTGGATCCCAGCTACTCGG - Intergenic
1070270038 10:74944681-74944703 CGCCTGTGTTCCCAGCTACTCGG + Intronic
1070509883 10:77151351-77151373 CACCTGAGTCCCTAGCTACTTGG - Intronic
1073395911 10:103217461-103217483 CGCCTGTGGCCCCAGCTACTCGG + Intergenic
1073591260 10:104759651-104759673 CGGCTCAGTCCTCACCTCCTTGG + Intronic
1075040858 10:119105410-119105432 CGCCTGAGGTCCCAGCTACTCGG - Intronic
1077010107 11:375893-375915 CGCCTACGCCCCCACCTACGTGG + Exonic
1078762797 11:14264897-14264919 TGCCTTACTCCCCAAGTACTTGG - Intronic
1080401017 11:31935494-31935516 CGCCTTTAACCCCAGCTACTTGG - Intronic
1081441100 11:43082157-43082179 CGCCTGTGGCCCCAGCTACTTGG + Intergenic
1081579479 11:44342354-44342376 AGCCTTTGGCCCCAGCTACTTGG - Intergenic
1084600435 11:70142356-70142378 CCCCTTCGTCCCCACCTAGCTGG - Intronic
1084888838 11:72226706-72226728 CTCCTTAGTCTCCCCCTACTGGG - Intronic
1085586789 11:77715893-77715915 CGCCTTTGGTCCCAGCTACTGGG - Intronic
1086385702 11:86305123-86305145 CGCCTTTGGTCCCAGCTACTCGG - Intronic
1087045175 11:93838669-93838691 CGCCTGTGTTCCCAGCTACTGGG + Intronic
1089567996 11:119382277-119382299 CGCCTTGGTACCCAGCTACCTGG - Intergenic
1091723032 12:2827106-2827128 CACCATAGTCCCCAGCTACCTGG + Exonic
1092736631 12:11588831-11588853 CGCCTGTGACCCCAGCTACTCGG - Intergenic
1093465307 12:19442280-19442302 CGCCTGTGTTCCCAGCTACTCGG + Intronic
1094704484 12:32900868-32900890 CGCCTGAGGTCCCAGCTACTTGG + Intergenic
1096061900 12:48708419-48708441 CGCCTTTGGTCCCAGCTACTTGG + Intronic
1096270413 12:50161998-50162020 CGCCTTAAGTCCCAGCTACTTGG - Intronic
1096491694 12:52016099-52016121 AGCCTTGGTCACCACCTGCTTGG - Intergenic
1096722557 12:53534149-53534171 CGCCTGTGTTCCCAGCTACTCGG + Intronic
1099443153 12:82722614-82722636 CGCCTGTGATCCCACCTACTCGG + Intronic
1102702211 12:114849367-114849389 CCCCTTAGTCCCCATATGCTTGG - Intergenic
1103675773 12:122654529-122654551 CGCCTGTGTTCCCAGCTACTTGG + Intergenic
1104046742 12:125168516-125168538 CGCCTTTGGTCCCAGCTACTCGG + Intergenic
1104056655 12:125235927-125235949 CGCCTGTGGCCCCAGCTACTCGG - Intronic
1104796914 12:131526465-131526487 CGCCTGTGGCCCCATCTACTCGG - Intergenic
1104977657 12:132559515-132559537 CGCCTGTGGCCCCAGCTACTGGG - Intronic
1105495328 13:20925776-20925798 CGCCTGAAATCCCACCTACTCGG + Intergenic
1105560255 13:21484109-21484131 CGCCTTGGTCACCGCCTTCTTGG + Intergenic
1106503357 13:30350173-30350195 CGCCTTTATTCCCAGCTACTTGG + Intergenic
1109494949 13:63157767-63157789 TGCCTGTGTCCCCAGCTACTTGG - Intergenic
1109528227 13:63604841-63604863 CGCCTATGACCCCAGCTACTCGG - Intergenic
1110167824 13:72464519-72464541 CGCCTGTGGCCCCAGCTACTCGG - Intergenic
1114244546 14:20900464-20900486 CACTTTAGCCCCCACCTCCTGGG + Intergenic
1114517152 14:23307425-23307447 CTCCTTAGTCCACACCTTCTTGG - Intronic
1116350907 14:43861568-43861590 CGCCTTTGGTCCCAGCTACTTGG - Intergenic
1116935066 14:50731403-50731425 CGCCTTTGGTCCCAGCTACTCGG + Intronic
1121369210 14:93341646-93341668 TGCCTGTGTTCCCACCTACTTGG + Intronic
1121429694 14:93878220-93878242 TGCCTTTATCACCACCTACTCGG - Intergenic
1121761314 14:96447438-96447460 CGCCTGTGTTCCCAGCTACTTGG - Intronic
1122663838 14:103315674-103315696 CTCCTACGTCCCCTCCTACTTGG + Intergenic
1122912924 14:104842159-104842181 ACCCTTAGTCCCCAGCTATTTGG - Intergenic
1123712389 15:22998187-22998209 CGCCTGAGATCCCAGCTACTCGG + Intronic
1123737026 15:23195499-23195521 CGCCTTAAGTCCCAGCTACTCGG + Intergenic
1124026470 15:25971301-25971323 CGCCTGTGTCCCCACCCAGTTGG + Intergenic
1124287724 15:28418475-28418497 CGCCTTAAGTCCCAGCTACTCGG + Intergenic
1124288245 15:28424176-28424198 CGCCTTAAGTCCCAGCTACTCGG + Intergenic
1124294980 15:28493151-28493173 CGCCTTAAGTCCCAGCTACTCGG - Intergenic
1125043182 15:35215507-35215529 CGCCTGTGTTCCCAGCTACTTGG - Intergenic
1125687509 15:41572361-41572383 TGCATAAGTCCCCACCTGCTGGG - Intronic
1125798186 15:42419822-42419844 CGCCTGTGTTCCCAGCTACTAGG + Intronic
1126007977 15:44276824-44276846 GTCTGTAGTCCCCACCTACTTGG + Intergenic
1126679874 15:51192518-51192540 AACCATAGTGCCCACCTACTGGG - Intergenic
1127787505 15:62368877-62368899 TGCCTTTGACCCCAGCTACTTGG - Intergenic
1128265769 15:66265555-66265577 TGCCTGTGGCCCCACCTACTTGG + Intergenic
1129350182 15:74951499-74951521 CGCCTGTGATCCCACCTACTTGG - Intergenic
1129354036 15:74975843-74975865 CGCCTGTGTTCCCAGCTACTTGG + Intronic
1129656515 15:77528466-77528488 CGCCCTCCTCCCCACCTTCTGGG - Intergenic
1129895351 15:79101553-79101575 CACCTAAGGCCCCAGCTACTTGG - Intergenic
1130216959 15:81981100-81981122 CGCCTGTGTTCCCAGCTACTTGG - Intergenic
1130364345 15:83220654-83220676 CGCCTGTGTTCCCAGCTACTTGG + Intergenic
1132903306 16:2269842-2269864 TGCCTTTGTCCCCAACTCCTTGG - Intergenic
1133009594 16:2903702-2903724 CGCCTGTATTCCCACCTACTCGG - Intergenic
1133049859 16:3111491-3111513 CGCCTGTGGCCCCAGCTACTTGG + Intergenic
1133159630 16:3901998-3902020 CGCCTTTGGTCCCAACTACTTGG - Intergenic
1134388892 16:13800349-13800371 CCCCTGAGCCCCCACCTACTAGG + Intergenic
1135701969 16:24640601-24640623 CGCCTTTGGTCCCAGCTACTTGG + Intergenic
1136071143 16:27787971-27787993 CGCCTTAAGCCCCACCTAGTAGG + Exonic
1136503121 16:30684409-30684431 ACCTTTAGTCCCCAGCTACTTGG - Intergenic
1138568059 16:57847909-57847931 CGCCTGTGTCCCCAGCTACTTGG - Intronic
1139268768 16:65663039-65663061 CGCCTGTGGTCCCACCTACTCGG + Intergenic
1140827698 16:78722914-78722936 CGCCTGTAGCCCCACCTACTTGG + Intronic
1142252397 16:88998347-88998369 CGCCTATGTTCCCAGCTACTTGG + Intergenic
1142346696 16:89558654-89558676 CGCCTGTGGTCCCACCTACTTGG - Intergenic
1142403931 16:89875646-89875668 CGCCTGTGTTCCCAGCTACTTGG - Intronic
1144635308 17:16903525-16903547 CGCCTGTGATCCCACCTACTTGG + Intergenic
1144821578 17:18078467-18078489 CGCCTGTGACCCCAGCTACTTGG - Intergenic
1144852340 17:18250431-18250453 CGCCCTTGGCCCCACCTCCTTGG + Intronic
1145899215 17:28479086-28479108 TGCCTGTGGCCCCACCTACTTGG + Intronic
1146054758 17:29575543-29575565 CGCCTTGGTCCTCACACACTGGG + Intronic
1146738902 17:35263695-35263717 CGCCTTTGGTCCCAGCTACTTGG + Intronic
1146827116 17:36032506-36032528 GGCCCTAGTCCCCACCTCATGGG + Intergenic
1148800287 17:50220943-50220965 CGCCGTGGTCCCCTCCCACTGGG + Intergenic
1149512893 17:57257159-57257181 CGCCTGGGTCCCCCCCTTCTTGG + Intronic
1150463563 17:65372741-65372763 CGCCTTTGGTCCCAGCTACTCGG - Intergenic
1151589118 17:75031888-75031910 CACCTGAGTTCCCAGCTACTTGG - Intergenic
1151698585 17:75730727-75730749 CCTCTTAGCCCCCACCTGCTTGG - Intronic
1151891273 17:76951886-76951908 CGCCTGTGTTCCCAGCTACTCGG + Intergenic
1153637635 18:7126915-7126937 CGCCTCCATTCCCACCTACTTGG + Intergenic
1154046483 18:10910455-10910477 CGCCTGAGATCCCAGCTACTTGG + Intronic
1156070016 18:33195974-33195996 GGCCTTTGCCCTCACCTACTGGG + Intronic
1157013202 18:43677806-43677828 GGGCATAGTCCCTACCTACTGGG + Intergenic
1158147775 18:54335318-54335340 CGCCTGTGACCCCAGCTACTCGG - Intronic
1158810369 18:61026593-61026615 CTCCTTAATCTACACCTACTGGG + Intergenic
1160571800 18:79822562-79822584 CGCCTGTGGCCCCAGCTACTCGG - Intergenic
1160997555 19:1890426-1890448 CGCCTTTGGTCCCAGCTACTCGG - Intergenic
1161109796 19:2462741-2462763 CGCCTGTGACCCCAGCTACTCGG + Intergenic
1161539818 19:4843708-4843730 CGCCTGTGTTCCCAGCTACTTGG + Intronic
1161954733 19:7487191-7487213 CTCCTTACTTCCCACCTCCTAGG + Intronic
1161968551 19:7562381-7562403 CGCCTGTGGCCCCAGCTACTTGG - Intergenic
1163387078 19:17006395-17006417 CGCCTGTGGTCCCACCTACTTGG + Intronic
1163456942 19:17412390-17412412 CACCTTTGATCCCACCTACTTGG - Intronic
1163694195 19:18755112-18755134 CGCCTGTGACCCCAACTACTCGG - Intronic
1167070890 19:47221514-47221536 CGGCTCAGTCCCCACCCCCTCGG + Exonic
1167926949 19:52828984-52829006 CGCCTGTGTTCCCAGCTACTCGG - Intronic
1168552477 19:57309165-57309187 CGCCTTTAGTCCCACCTACTCGG + Intergenic
927514477 2:23663995-23664017 CGCCCCAGTCCCCAACCACTCGG - Intronic
929206226 2:39297241-39297263 CGCCTGAGGTCCCAGCTACTCGG - Intronic
929447029 2:42009769-42009791 CGCCTTTAGCCCCAGCTACTCGG - Intergenic
930861065 2:56073115-56073137 GGCCTTAGTCCCAAACTTCTGGG - Intergenic
932028910 2:68163403-68163425 CGCCTTTAGTCCCACCTACTCGG + Intronic
933054466 2:77644214-77644236 CACCTTTGACCCCAGCTACTTGG - Intergenic
933484597 2:82903073-82903095 CGCCTGTTACCCCACCTACTTGG - Intergenic
936346519 2:111679754-111679776 TGCCTTTGTTCCCAGCTACTTGG - Intergenic
938045036 2:128111227-128111249 CGCCTTTGGTCCCAGCTACTCGG + Intronic
938085220 2:128395481-128395503 CGCCAGAGTCCCCTCCTTCTAGG + Intergenic
939635446 2:144576339-144576361 CGCCTGTGTTCCCAGCTACTCGG + Intergenic
940215493 2:151299419-151299441 CGCCTGTAGCCCCACCTACTCGG - Intergenic
941784654 2:169484255-169484277 CGCCTGTGGCCCCAGCTACTGGG + Intronic
943872627 2:193020955-193020977 CGCCTGTATCCCCAGCTACTCGG + Intergenic
944654207 2:201861684-201861706 CGCCTGTATTCCCACCTACTCGG - Intronic
944658129 2:201897380-201897402 CGCCTGTGGTCCCACCTACTTGG + Intergenic
944969807 2:204979078-204979100 CGCCTTTAGTCCCACCTACTTGG + Intronic
945057051 2:205878421-205878443 CGCCTATGGCCCCAGCTACTTGG + Intergenic
945136917 2:206639352-206639374 CCCCTTCTTCCCTACCTACTTGG + Intergenic
945224355 2:207517993-207518015 ACCCTTAATCCCCACCTACAAGG + Intergenic
945248007 2:207738344-207738366 CGCCTGTAACCCCACCTACTCGG - Intronic
1170000896 20:11612300-11612322 CGCCTGTAGCCCCACCTACTTGG + Intergenic
1170826286 20:19799023-19799045 CGCCTATGGTCCCACCTACTGGG - Intergenic
1171466960 20:25336608-25336630 CGCCACAGACCCCACCTCCTCGG + Intronic
1172359437 20:34302124-34302146 CGCCTTCATTCCCAGCTACTCGG - Intronic
1172676096 20:36673529-36673551 CGCCTGTGTTCCCAGCTACTCGG - Intronic
1174821600 20:53731129-53731151 CGCCTTTAACCCCAGCTACTTGG + Intergenic
1178683597 21:34694096-34694118 TGCTGTAGTCCCCAGCTACTTGG - Intronic
1178857260 21:36260627-36260649 AGCCTTATTTCCCACCAACTCGG + Intronic
1178862919 21:36304318-36304340 CGCCTGTGGCCCCAGCTACTTGG - Intergenic
1180205326 21:46256108-46256130 CTCCCCAGTCCCCACCCACTGGG + Intronic
1180300600 22:11033646-11033668 CGCCTGTGACCCCAGCTACTCGG - Intergenic
1180665285 22:17505968-17505990 AGCCTGTGTCCCCAGCTACTTGG - Intronic
1180889585 22:19276793-19276815 CGCCTGAAGCCCCAGCTACTTGG - Intronic
1181494854 22:23282081-23282103 CGCCTGAGACCCCTCCTCCTTGG + Intronic
1181591361 22:23887159-23887181 CGCCTGTGGTCCCACCTACTTGG - Intronic
1183409169 22:37644953-37644975 GGCCTATGTCCCCACCTGCTTGG - Exonic
1184389034 22:44192535-44192557 TGTCTTACTCCCCACCCACTGGG + Intronic
950232288 3:11286721-11286743 CGCCTGTGTTCCCAGCTACTTGG - Intronic
950397110 3:12742102-12742124 CGCCTGTGGTCCCACCTACTCGG + Intronic
950834049 3:15902548-15902570 CACCTGAATCCCCAACTACTCGG - Intergenic
951228552 3:20149368-20149390 CGCCTGAGGCCCCAGCTACTTGG + Intronic
953392024 3:42539461-42539483 TGCCTTAGCCCCCAACTTCTTGG - Intergenic
957332846 3:78788239-78788261 CGCCTTTAGCCCCAGCTACTCGG - Intronic
958943102 3:100335884-100335906 CCCTTTAGTCCCAAACTACTTGG + Intronic
959458121 3:106589328-106589350 CCTCTTTGTCCCCAGCTACTAGG + Intergenic
960101042 3:113744336-113744358 CGCCTGAGGTCCCACCGACTCGG + Intronic
961563907 3:127749947-127749969 CCCCTCTGTTCCCACCTACTGGG - Intronic
962815049 3:138989853-138989875 CGCCTGTAACCCCACCTACTTGG - Intergenic
963139549 3:141936275-141936297 CGCCTGTGACCCCAGCTACTTGG + Intergenic
963896245 3:150688004-150688026 CACCTTAGCCCCCACTAACTGGG - Intronic
964875088 3:161358139-161358161 CGCCTATATTCCCACCTACTTGG - Intronic
965810491 3:172587146-172587168 TGACTTATTCCCCACCTACCTGG + Intergenic
966338455 3:178898164-178898186 CGCCTGTATTCCCACCTACTTGG - Intergenic
969386334 4:6851585-6851607 CGCCTGAGTCCCCAGCTACTTGG + Intronic
971782621 4:31056240-31056262 CGCCTGTGGCCCCAGCTACTTGG + Intronic
972498158 4:39653011-39653033 CGCCTGTGGCCCCAGCTACTCGG - Intergenic
972884028 4:43463309-43463331 CGCCTGAAGCCCCAACTACTCGG - Intergenic
975703856 4:77092331-77092353 CGCCTGAGGTCCCAGCTACTTGG + Intergenic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
978156203 4:105491718-105491740 CGCCTGAATCCCCAGCTACCTGG - Intergenic
978808250 4:112822618-112822640 CGCCTGTGGCCCCAGCTACTAGG + Intronic
981549822 4:145932598-145932620 CGCCTGAGGTCCCAGCTACTCGG - Intronic
981762611 4:148210314-148210336 CGCCTGTGTTCCCAGCTACTTGG - Intronic
988445632 5:31283153-31283175 GTCCTTTGTCCCTACCTACTAGG - Intronic
990952251 5:61310082-61310104 CACCTGTGTTCCCACCTACTTGG + Intergenic
993900137 5:93579520-93579542 CGCCTTGGCCCTCACCTACAGGG + Intergenic
997038988 5:130229135-130229157 CGCCTGTATTCCCACCTACTCGG + Intergenic
999156839 5:149464220-149464242 CGCCTGTGACCCCAGCTACTTGG - Intergenic
1000686061 5:164250923-164250945 CGCCTGTATCCCCAGCTACTCGG + Intergenic
1001271702 5:170317462-170317484 CTCCTTATTGCCCACCTACCGGG + Intergenic
1002900447 6:1406156-1406178 CGCCTGAGGTCCCAGCTACTCGG + Intergenic
1003101309 6:3178487-3178509 TGCCTGTATCCCCACCTACTCGG - Intergenic
1004780427 6:18902655-18902677 CGCCTTTGGTCCCAACTACTAGG - Intergenic
1005470541 6:26158213-26158235 AGCCTTAGTCACCGCCTTCTTGG - Exonic
1005480601 6:26251694-26251716 CGCCTTGGTCACCGCCTTCTTGG - Exonic
1005569662 6:27132685-27132707 CGCCTTAGTCACCGCCTTCTTGG + Exonic
1006118255 6:31787099-31787121 CACCTTTGTTCCCAGCTACTTGG + Intronic
1006735028 6:36267528-36267550 CCCCGTTGTCCCCACCTGCTTGG - Intronic
1009015112 6:57891103-57891125 CGCCTGAATTCCCAGCTACTCGG - Intergenic
1009987558 6:70800155-70800177 CTCTGTAGTCCCCAGCTACTTGG + Intronic
1011688100 6:89840235-89840257 CGCCTTTAGTCCCACCTACTCGG + Intronic
1015313819 6:131794457-131794479 CGCCTTTGGTCCCAGCTACTTGG + Intergenic
1015703128 6:136057860-136057882 CGCCTGTGACCCCAGCTACTTGG - Intronic
1016888509 6:148982222-148982244 CGCCTGTAGCCCCACCTACTTGG - Intronic
1017378346 6:153797477-153797499 GGGCATAGTCCCTACCTACTGGG + Intergenic
1020168365 7:5825350-5825372 CGCCTGTGATCCCACCTACTCGG - Intergenic
1021171534 7:17403636-17403658 CGCCTTTGGTCCCAGCTACTTGG + Intergenic
1022019014 7:26380538-26380560 TGCCTAAGTTCCCAGCTACTTGG + Intergenic
1022118047 7:27279441-27279463 CGCCTGTGGCCCCAGCTACTCGG - Intergenic
1022669989 7:32446747-32446769 CGCTTTAGTCCTCACCTCGTGGG - Intergenic
1026167978 7:67928000-67928022 CACCTTATTCCCCATCTTCTTGG + Intergenic
1027026093 7:74852620-74852642 CGCCTGTGATCCCACCTACTCGG - Intergenic
1027061663 7:75091499-75091521 CGCCTGTGATCCCACCTACTCGG + Intergenic
1027833392 7:83209944-83209966 GGCTATAGTCCCCAGCTACTTGG - Intergenic
1028038585 7:86018618-86018640 CGCCTGTGGCCCCAGCTACTCGG - Intergenic
1029305616 7:99617453-99617475 CGCCTGAGGTCCCAGCTACTCGG + Intronic
1029597015 7:101543293-101543315 CGCCTGTGGCCCCAGCTACTGGG - Intronic
1029631848 7:101757042-101757064 TGCCTGTGGCCCCACCTACTCGG + Intergenic
1030186741 7:106769846-106769868 CGCCTGTGTTCCCAGCTACTCGG + Intergenic
1031989857 7:128190405-128190427 GGACTTAGTCCCCAGCTGCTGGG - Intergenic
1034408847 7:150926196-150926218 CACCTGTGTCCCCAGCTACTCGG + Intergenic
1035017138 7:155776419-155776441 CTCCTTAGTCCCTTCCTTCTAGG - Exonic
1036406348 8:8458768-8458790 CGCCCTTCTCCCCACTTACTTGG - Intergenic
1036784202 8:11674913-11674935 CGCCTGTGGTCCCACCTACTTGG + Intergenic
1036936950 8:13012447-13012469 CGCCTATGATCCCACCTACTCGG + Intronic
1036950996 8:13139162-13139184 CGCCTGTGTTCCCAGCTACTTGG + Intronic
1037997498 8:23363998-23364020 CGCCTTTGGTCCCAGCTACTTGG - Intronic
1039897923 8:41729514-41729536 CGCCTTAGTCCCCACCTACTTGG - Intronic
1040502694 8:48019237-48019259 CGCCTGTGACCCCAGCTACTTGG + Intronic
1041685605 8:60641978-60642000 CGCCTGTGGCCCCAGCTACTTGG - Intergenic
1042906845 8:73780633-73780655 CACCTTAGTTTCCAGCTACTTGG + Intronic
1049574933 8:143385597-143385619 GGCCTTAGCCCCCACTTTCTGGG + Intergenic
1051016722 9:12485765-12485787 CGCCTGTAACCCCACCTACTAGG + Intergenic
1052038872 9:23715272-23715294 CGCCTGTGTTCCCAGCTACTCGG - Intronic
1052298661 9:26929071-26929093 CGCCTGTGTTCCCAGCTACTTGG + Intronic
1053250244 9:36568176-36568198 CGCCTTTAGTCCCACCTACTTGG + Intergenic
1054797501 9:69316358-69316380 TGCCTTTAGCCCCACCTACTTGG + Intergenic
1055045835 9:71923002-71923024 CGCCTGTAACCCCACCTACTCGG + Intronic
1055492178 9:76816647-76816669 CTCCTAATTCCCCAGCTACTCGG + Intronic
1056161573 9:83901082-83901104 CGCCTGTGGTCCCACCTACTCGG - Intronic
1056358551 9:85828120-85828142 CGCCTGTGGTCCCACCTACTCGG + Intergenic
1057117217 9:92536993-92537015 CGCCTTTAAGCCCACCTACTCGG - Intronic
1061070730 9:128308783-128308805 CGCCTGTGACCCCAGCTACTTGG + Intergenic
1061462295 9:130750053-130750075 CGCCTGTGTTCCCAGCTACTTGG + Intronic
1062444461 9:136587860-136587882 CGCCTTGGTGCCCACCTGCTGGG - Intergenic
1187149650 X:16669822-16669844 TGCCTGAGTCCCCAGCTACAGGG + Intronic
1188495108 X:30775397-30775419 CACCTGAGGCCCCAGCTACTTGG + Intergenic
1189286574 X:39855935-39855957 CAGCTGAGACCCCACCTACTAGG - Intergenic
1189913664 X:45836267-45836289 GCCCATAGTCCCCAGCTACTCGG + Intergenic
1190312253 X:49124828-49124850 CGCCTGTATCCCCAGCTACTTGG + Intergenic
1196272746 X:113731712-113731734 CGCCTGTATTCCCACCTACTCGG - Intergenic
1201546674 Y:15172779-15172801 CGCCTGTGTTCCCACCTACTGGG - Intergenic
1201781721 Y:17730198-17730220 CGCCTGTGTTCCCAGCTACTTGG + Intergenic
1201819832 Y:18175792-18175814 CGCCTGTGTTCCCAGCTACTTGG - Intergenic