ID: 1039899650

View in Genome Browser
Species Human (GRCh38)
Location 8:41742148-41742170
Sequence CCAATGGAATTTCTCACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039899650 Original CRISPR CCAATGGAATTTCTCACAGT TGG (reversed) Intronic
900773653 1:4565327-4565349 CCAATGGAAGGTCACACAGTTGG - Intergenic
901099622 1:6709411-6709433 CCTATGGAATTTCTCTGAGTTGG + Intergenic
905133807 1:35782131-35782153 CCATTTTAATTTCTCATAGTTGG + Intergenic
908861904 1:68498703-68498725 ACATTAGAATTTCTCAGAGTGGG + Intergenic
917560694 1:176151769-176151791 CCAATGTGTTTTCTCCCAGTTGG - Intronic
917675192 1:177312087-177312109 CCAAGGGACTTTGGCACAGTTGG - Intergenic
917934062 1:179847302-179847324 AAAATGGAATTTCTCACAATAGG - Intronic
922049975 1:221979284-221979306 CCACTGGAAATACTCACTGTAGG - Intergenic
1063127386 10:3147653-3147675 CCAATGGAATTCCTGACTCTGGG - Exonic
1063964381 10:11335397-11335419 CCAGTGAAATCTCTCCCAGTAGG + Exonic
1067104148 10:43354485-43354507 CCAATGGATGATATCACAGTGGG - Intergenic
1071446490 10:85753554-85753576 GCAATGGGATATCTCACAGCTGG - Intronic
1071587087 10:86834185-86834207 GGAATGGAAATTGTCACAGTTGG + Intronic
1077815905 11:5685115-5685137 CCAATGGCATTTCTCCACGTAGG + Intronic
1082319510 11:50783164-50783186 CAAATTCAATTTATCACAGTAGG + Intergenic
1083432392 11:62620859-62620881 ACAATGGAATTTATTAAAGTTGG - Intronic
1088878488 11:113955391-113955413 CCATTAGAATTTCTCTCGGTAGG + Intergenic
1089667762 11:120031230-120031252 CCCAAGGAAATTCTAACAGTGGG + Intergenic
1093665324 12:21805545-21805567 ACAATGAGATATCTCACAGTAGG - Intronic
1095542433 12:43326082-43326104 CAAATGAAATTTCTCACACCTGG + Intergenic
1096532076 12:52248587-52248609 CCAGTGGAATTCATCACAGCTGG - Exonic
1097059713 12:56273599-56273621 CCAATGTAGATGCTCACAGTGGG - Exonic
1097445926 12:59670742-59670764 CTAATGGAATTTGTCCCACTAGG - Intronic
1099723007 12:86388538-86388560 CCAATTAAATTTATCACAGAAGG + Intronic
1100172172 12:91987582-91987604 GCAATGCAATTTGTCACAGAAGG - Exonic
1102832737 12:116020515-116020537 TAAATGAAATTTCTAACAGTGGG + Intronic
1107896461 13:44969515-44969537 ACAAGGGAAATTTTCACAGTTGG + Intronic
1108719335 13:53114829-53114851 CCAAATGAATTTCTGACATTTGG - Intergenic
1109513398 13:63408422-63408444 CCAAAGGAATTTCAAACAGCAGG + Intergenic
1119457389 14:74767924-74767946 CCAATGGCATTACTAACAGTGGG - Intronic
1122579564 14:102763008-102763030 GCAATAGAATTTCTGACATTTGG - Intergenic
1123821410 15:24034518-24034540 CAAATGGTATTTCTGACACTAGG - Intergenic
1123900288 15:24870031-24870053 CCATTGGAAGGTCTCTCAGTTGG + Intronic
1128718367 15:69926972-69926994 CCAATGGCATCTGTGACAGTGGG + Intergenic
1141892869 16:86938782-86938804 CAAATGGAAATACTCTCAGTGGG + Intergenic
1142622299 17:1172790-1172812 GCAATGGACTTTCTCACATGTGG + Intronic
1146663830 17:34683456-34683478 AGAATGGAATTTCTCCCAGTGGG + Intergenic
1146682084 17:34815608-34815630 CCAATGGGAATTGTCACAGGAGG + Intergenic
1150784949 17:68154715-68154737 CCAAAAGAATGTCTCACTGTGGG - Intergenic
1152328116 17:79654305-79654327 CCAAAGAATTTTTTCACAGTGGG + Intergenic
1153021331 18:631876-631898 ACACTGGAAATTCTCACAGGGGG + Intronic
1158388737 18:57024971-57024993 CCAAAGGCATTTATCAAAGTAGG + Intronic
1159164077 18:64681224-64681246 GCAATTGAATGTCTCTCAGTAGG - Intergenic
1159238136 18:65704482-65704504 CCAACGGAATTTAACACATTTGG - Intergenic
1159273310 18:66182115-66182137 CCATTGGAAGCTCTCTCAGTTGG - Intergenic
1160453829 18:78981793-78981815 CACATAGAATTTCTCACACTTGG + Intronic
1163563000 19:18031824-18031846 CCAATGTAGATGCTCACAGTGGG + Intergenic
1166587608 19:43964569-43964591 ACAATGGAAATTATCAAAGTTGG + Intronic
925819763 2:7788550-7788572 TCAATAGCATTTCACACAGTTGG - Intergenic
928599825 2:32893584-32893606 CCAATGGTGTATCTCCCAGTTGG - Intergenic
931638755 2:64363149-64363171 CCAGTGGAAGTTCTGACAGTGGG - Intergenic
932088850 2:68786964-68786986 CAAATGGAAATCCTCAAAGTTGG - Intronic
935801403 2:106700373-106700395 CCACTGGAAGTTCTTACAGTTGG - Intergenic
937936372 2:127248956-127248978 CAAATGGATTTTCTTACTGTTGG - Intergenic
942228750 2:173839979-173840001 CCATTGGAAGTTCTTTCAGTTGG + Intergenic
942256568 2:174107382-174107404 GCAAAGCAATTTCCCACAGTGGG + Intronic
943539739 2:189197690-189197712 TCCCTGGAATTTCTCACAGTTGG - Intergenic
946759246 2:222976918-222976940 CCAATTGAGTTTCTCTCAGAGGG + Intergenic
947346071 2:229190390-229190412 CCAATGGAATTCCTGGCATTTGG + Intronic
1169844648 20:9976401-9976423 CCAAAGGGAATTCTCACAATAGG - Intergenic
1169904127 20:10583502-10583524 CCTCTGGAATTTCCCACATTTGG + Intronic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1173910708 20:46667790-46667812 CCAAGAGAATTGCTCACTGTAGG - Intronic
1178062960 21:28872417-28872439 GAAATGGAATCTTTCACAGTGGG + Exonic
1179719299 21:43306330-43306352 CCAATGGGCATTCGCACAGTGGG - Intergenic
1182635759 22:31725610-31725632 CCACTGGATTTTCTTACTGTAGG - Exonic
951754201 3:26071759-26071781 CCAAGAGAATTTCTAACACTGGG - Intergenic
952328142 3:32339372-32339394 CCAAAGGAATCTTACACAGTTGG + Intronic
952336152 3:32404774-32404796 CCAATGGAATATGGCACAGGTGG + Intronic
956468413 3:69541583-69541605 GAAATGGCATTTCTCAAAGTAGG + Intronic
957852943 3:85833884-85833906 CCAATGGCATTTTTAACAGATGG - Intronic
960224385 3:115152176-115152198 CCAATGACATTTCTTTCAGTTGG + Intergenic
960726060 3:120671594-120671616 CAAATGGTATTTCTCATTGTAGG - Intronic
962320623 3:134387633-134387655 CAAATGGAATTACTCCCAATAGG - Intergenic
962961528 3:140315569-140315591 ACAATGGAAGGTCTCACATTTGG - Intronic
963367290 3:144352443-144352465 AGAATGGCATTTCTCAAAGTAGG - Intergenic
963388370 3:144625947-144625969 TTTATGGAATTCCTCACAGTTGG + Intergenic
965440298 3:168704349-168704371 CTGATGGAATTTCTCAGAATTGG - Intergenic
968005500 3:195239903-195239925 CTAATGACATTTCTCAAAGTAGG + Intronic
969207210 4:5655897-5655919 CCAGTGGAATATCTCACAACAGG + Intronic
969586274 4:8095898-8095920 GCAGAGGAATTTCACACAGTGGG - Intronic
970830275 4:20330653-20330675 CAATTCTAATTTCTCACAGTTGG + Intronic
970978482 4:22069878-22069900 CCACTGGAATTGCCCCCAGTGGG + Intergenic
976904177 4:90216003-90216025 CCATCAGAATTTTTCACAGTTGG - Intronic
977083059 4:92558051-92558073 CCAATGAAGTTTCTTACATTTGG + Intronic
979271369 4:118766472-118766494 CCAATAGAATTATTCACACTAGG - Intronic
980324275 4:131321844-131321866 CCAATAGAATTCTTCACAGAAGG + Intergenic
980536975 4:134137959-134137981 GTAATGGAATTTCTCACATATGG - Intergenic
981530814 4:145752213-145752235 CAGAAGGAATCTCTCACAGTAGG + Intronic
984979061 4:185260051-185260073 TCAAGTGAATTTCTCACAGCGGG - Intronic
985260448 4:188110107-188110129 CCTATGGAATCTGTCACAGATGG + Intergenic
987601228 5:20073855-20073877 CCTATGGAATTTCTGAGATTTGG + Intronic
988968988 5:36447048-36447070 CCAGTTGTATTTCTCCCAGTAGG + Intergenic
992530517 5:77647593-77647615 CCAAAGGCATTTCACACATTAGG + Intergenic
994554573 5:101282299-101282321 CCAATGGTCTTACTTACAGTGGG + Intergenic
997800740 5:136858721-136858743 CCATTGGAAATTCTTTCAGTTGG + Intergenic
1001025195 5:168218327-168218349 CCATTGCCATTTCTCACACTGGG + Exonic
1002901815 6:1416271-1416293 CCCATGCAATTTCTCATGGTTGG + Intergenic
1008459612 6:51753111-51753133 TAAATGAAAATTCTCACAGTTGG + Intronic
1009317572 6:62240222-62240244 CCACTGGGAGTTCTCTCAGTAGG + Intronic
1009650486 6:66470925-66470947 ACAAGTGAATTTCTCACAGTAGG + Intergenic
1011710247 6:90045762-90045784 CAAAAGGAATTTTTCACAGTGGG - Intronic
1011927722 6:92668667-92668689 AAAATGGAATTTCTCAAGGTGGG - Intergenic
1012033419 6:94101522-94101544 CAAAGGGAAATTCTCCCAGTGGG + Intergenic
1012080488 6:94751908-94751930 AAAATGGAATTTCCCTCAGTGGG + Intergenic
1012130048 6:95479447-95479469 CCAATAGAATTTATGAGAGTTGG - Intergenic
1012923462 6:105244315-105244337 GCAATGGTGCTTCTCACAGTGGG - Intergenic
1015061500 6:128972025-128972047 CCAGTGGAATTTCCTACACTGGG + Intronic
1017958355 6:159199046-159199068 ACAATGACATTTCTCAAAGTAGG - Intronic
1021593072 7:22285764-22285786 CCAGTGGTATTTCTCAGAGGAGG + Intronic
1022450873 7:30513465-30513487 CCAGTGGAATTTCTCACTGTAGG + Intronic
1027608011 7:80324338-80324360 CCAGTGGAATTTGGCCCAGTAGG + Intergenic
1028881320 7:95883251-95883273 CAAATGCAATTTCTCACACAGGG - Intronic
1032590132 7:133184191-133184213 ACAATAGCATTTCTCAGAGTTGG + Intergenic
1033944214 7:146695366-146695388 TCAATGTAATTTATCACAATAGG - Intronic
1036909972 8:12749434-12749456 CCAAAGGTATTTCTCAAAATTGG - Intronic
1039899650 8:41742148-41742170 CCAATGGAATTTCTCACAGTTGG - Intronic
1040089402 8:43381589-43381611 CCATTAAAATTTCTCACATTTGG + Intergenic
1040402708 8:47068360-47068382 CCATTAAAATTTCTCACATTTGG - Intergenic
1040490164 8:47912996-47913018 CCAATAGAATTTCTCAATGCAGG - Intronic
1041371805 8:57169426-57169448 GCAATGGGATTTCTCACACATGG - Intergenic
1042237531 8:66627932-66627954 CGCATGGAATTTCTCTCATTTGG + Intergenic
1044435721 8:92160519-92160541 CCTATGGAGTTTATTACAGTGGG + Intergenic
1044824268 8:96181402-96181424 TGAAAGGAATTTCTCACACTGGG + Intergenic
1049050803 8:140193665-140193687 CCAGTGGACTTTCTAGCAGTAGG - Intronic
1050483617 9:6111412-6111434 ACAATCGATTTTCTCACAGGAGG + Intergenic
1056939172 9:90940634-90940656 CACATGCAATTTATCACAGTAGG - Intergenic
1060673193 9:125488647-125488669 CCAGTGTCATTTCTCAAAGTAGG + Intronic
1061680177 9:132239072-132239094 CCATTGGTATTTCTCCCACTTGG + Intronic
1061762158 9:132858375-132858397 CCAGTGGGCTTTCTCACACTGGG + Intronic
1186092462 X:6064438-6064460 ACAATGGAAATTCTCCCAGCGGG - Intronic
1187376316 X:18758299-18758321 ACATTGAAATTCCTCACAGTTGG + Intronic
1188638646 X:32469266-32469288 CACATGTAATTTCTTACAGTAGG + Intronic
1188708269 X:33362416-33362438 CAAATGGTATTTCTGACTGTAGG - Intergenic
1188708727 X:33367127-33367149 CAAATGGTATTTCTGACTGTAGG + Intergenic
1191092937 X:56642939-56642961 CGAATGGAATTGCTCAGATTTGG + Intergenic
1199039981 X:143101988-143102010 CCAATGAAGTTTCTCTCAGCGGG - Intergenic
1202578669 Y:26355280-26355302 CAAATGCAATTTTTCTCAGTGGG + Intergenic