ID: 1039901168

View in Genome Browser
Species Human (GRCh38)
Location 8:41753511-41753533
Sequence CAACTGGGACAGCGTGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039901168_1039901175 23 Left 1039901168 8:41753511-41753533 CCAGGGGCACGCTGTCCCAGTTG 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1039901175 8:41753557-41753579 AGATTCGGGGGTACCTGTGCAGG No data
1039901168_1039901172 9 Left 1039901168 8:41753511-41753533 CCAGGGGCACGCTGTCCCAGTTG 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1039901172 8:41753543-41753565 TCAACTTCTAGTTTAGATTCGGG No data
1039901168_1039901173 10 Left 1039901168 8:41753511-41753533 CCAGGGGCACGCTGTCCCAGTTG 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1039901173 8:41753544-41753566 CAACTTCTAGTTTAGATTCGGGG No data
1039901168_1039901171 8 Left 1039901168 8:41753511-41753533 CCAGGGGCACGCTGTCCCAGTTG 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1039901171 8:41753542-41753564 TTCAACTTCTAGTTTAGATTCGG No data
1039901168_1039901174 11 Left 1039901168 8:41753511-41753533 CCAGGGGCACGCTGTCCCAGTTG 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1039901174 8:41753545-41753567 AACTTCTAGTTTAGATTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039901168 Original CRISPR CAACTGGGACAGCGTGCCCC TGG (reversed) Intronic
900513670 1:3071500-3071522 CAGCTGGGACCGCTTGTCCCAGG + Intronic
906506403 1:46383110-46383132 GGACTGGGACAGGGTGACCCTGG + Intergenic
906707763 1:47907156-47907178 CAGCTGGGGCTGCGGGCCCCAGG + Intronic
912749124 1:112270868-112270890 GAAGAGGGACAGCTTGCCCCTGG - Intergenic
915440839 1:155944598-155944620 GAACTGGGACAGGGGGCACCTGG - Intergenic
916628582 1:166587332-166587354 AAACTGGGATAGAATGCCCCGGG - Intergenic
917494635 1:175529205-175529227 CAAATGGGACACTGAGCCCCAGG + Intronic
919924145 1:202183592-202183614 CAGCTGGGTCAGCCTGACCCTGG - Intergenic
923720344 1:236461770-236461792 CGAATGGGAAAGCATGCCCCAGG - Intronic
1068120418 10:52778581-52778603 CAACAGGGACACCGCGCTCCGGG - Intergenic
1068530384 10:58179452-58179474 CAGCTAGGAAAGCGTGCCTCCGG - Intergenic
1070542553 10:77426845-77426867 CAAGTTGGAAAGCGTGGCCCTGG - Intronic
1070791816 10:79194105-79194127 CCACTGGCACCGCTTGCCCCAGG + Intronic
1073218558 10:101850901-101850923 CAACTGTGACAGCCTGGCCAGGG - Intronic
1075275133 10:121086327-121086349 CAACTGGGAGAACGTGCTCTGGG - Intergenic
1078642935 11:13113346-13113368 CAACTGGGACACTGGGCTCCAGG + Intergenic
1084736491 11:71108727-71108749 CAGAGGGGACAGAGTGCCCCCGG - Intronic
1084757559 11:71249380-71249402 TAACTGGGACTGTGAGCCCCAGG - Intronic
1090333667 11:125949009-125949031 CATGTGGGACAGCGAGCTCCAGG - Intergenic
1099249497 12:80235666-80235688 CAACTGGGGCAGCATGCACAAGG + Intronic
1100781415 12:98030614-98030636 CAACTGCTACAGTGTGCTCCTGG + Intergenic
1101068280 12:101046078-101046100 CAGAGAGGACAGCGTGCCCCAGG + Intronic
1102228114 12:111243695-111243717 CAACTGTCACAGCTTGGCCCTGG + Intronic
1104676585 12:130715532-130715554 CCACTGGGAGAGTCTGCCCCCGG + Intronic
1106692423 13:32132605-32132627 CAAATGGTACAGCTTGGCCCTGG + Intronic
1112508995 13:99991817-99991839 CGCCTGGGTCTGCGTGCCCCTGG + Intergenic
1119213344 14:72849461-72849483 CATCTTGGACAGCATCCCCCGGG + Intronic
1121010203 14:90515702-90515724 CAACTGGGTCAGCGAGCGCACGG + Intergenic
1122969229 14:105145730-105145752 CAACCGTGACCACGTGCCCCAGG - Exonic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1126143413 15:45455374-45455396 CAGCTGGGACAGCCAGCCCCCGG - Intergenic
1132495712 16:262347-262369 CATGTGGCACTGCGTGCCCCTGG + Intronic
1132504827 16:302565-302587 CATCTGGGAAACCGTGCGCCGGG - Intronic
1132669684 16:1097491-1097513 CCAGTGGGACAGTGTGCTCCTGG + Intergenic
1133202901 16:4215319-4215341 CCACTGGGACAGCTTGTCCCTGG + Intronic
1134774372 16:16839005-16839027 CAACTGGGAGATTTTGCCCCAGG - Intergenic
1135648916 16:24188311-24188333 CCTCTGGAACAGCGAGCCCCAGG + Intronic
1142030602 16:87836557-87836579 CAACTGGCTCTGCGTGGCCCTGG - Exonic
1142104008 16:88292299-88292321 CAACTGGGGCAGGGTGGCCCAGG + Intergenic
1142808920 17:2386292-2386314 CAACCGGGTCAGAGAGCCCCAGG + Exonic
1146591748 17:34133427-34133449 CAACAGAGACAGCCTGACCCTGG - Intronic
1150673499 17:67223307-67223329 CCACAGGGACAGAGTGGCCCAGG + Intronic
1151479665 17:74362526-74362548 CACCTGGCTCAGCTTGCCCCTGG - Intergenic
1152459213 17:80432526-80432548 CAACCTGGACGGCATGCCCCAGG - Intronic
1152562557 17:81085869-81085891 CATTTGGGACCGAGTGCCCCTGG + Intronic
1152564723 17:81095205-81095227 CCACTGGGACTGCCTGCCCATGG + Intronic
1157502924 18:48203548-48203570 CAACAGGGACAGCGGCCCCATGG + Intronic
1158427289 18:57352001-57352023 CAACTGGGCCTGCCTGCCTCGGG - Exonic
1162142453 19:8592781-8592803 CGTCTGGCACAGCGTGCCCTCGG + Exonic
1167117642 19:47497466-47497488 CACCTGGGACAGCTGGCTCCTGG + Intronic
1167476841 19:49706227-49706249 CACCTGGGCCCACGTGCCCCTGG - Exonic
926088807 2:10036813-10036835 CCTCTTGGACAGAGTGCCCCAGG - Intergenic
926173669 2:10570037-10570059 CAAATGGGGCTGGGTGCCCCAGG + Intergenic
926197839 2:10774461-10774483 CAGCTGGCACAGGGTGTCCCTGG - Intronic
926204777 2:10828431-10828453 CTACTGGAACAGGGTGCTCCAGG - Intronic
932705425 2:74020845-74020867 CATCTGGTTCAGCGTGTCCCGGG + Intronic
937737675 2:125312458-125312480 CAGCGGGGAAGGCGTGCCCCGGG + Intergenic
948392911 2:237625680-237625702 CAACTGGCACAGCCAGTCCCTGG + Intergenic
948642082 2:239381978-239382000 CAACTGGGACTGTGTTGCCCTGG - Intronic
1171108255 20:22456614-22456636 GAACAGGGCCAGCATGCCCCGGG + Intergenic
1171750506 20:29044393-29044415 CAACAGGGAGATCGTGCCCTTGG + Intergenic
1172351991 20:34250248-34250270 CAACTCTGACAGCCTGCCCTGGG - Intronic
1176168735 20:63687722-63687744 CACCGGGGCCAGCGTGCCGCTGG - Exonic
1179355250 21:40652856-40652878 CAACTGACACAGCGTGGCCCAGG - Intronic
1182674986 22:32032163-32032185 CAAGTGGGACAGGGAGGCCCAGG + Intergenic
950413333 3:12853436-12853458 CAAGTAGGACAGCGAGCCCTAGG + Intronic
950522539 3:13505484-13505506 CACCTGGGTCAGCGGCCCCCTGG - Exonic
951801764 3:26603894-26603916 CAACTGGGACACAGGGCACCAGG + Intergenic
954306214 3:49726823-49726845 CAGCAGGGACAGGGTGCCCTTGG - Exonic
954326014 3:49864447-49864469 CCTGTGGGACACCGTGCCCCAGG - Intronic
960995841 3:123339543-123339565 CAACAGGGAGAGCCTGCCCTGGG + Intronic
961869559 3:129977554-129977576 CAAGTGGGACAGGGAGCCCCTGG + Exonic
969651222 4:8469424-8469446 CAACTGGGACCCAGAGCCCCAGG + Intronic
980568588 4:134579793-134579815 CAACTGGGACAGTTTGCCTGGGG + Intergenic
1000149800 5:158488506-158488528 CATCTTGGACAGCCTGCCCAAGG - Intergenic
1002043010 5:176528115-176528137 CAACTGGGACCGAGTGCCCAGGG - Exonic
1002066202 5:176653010-176653032 CACCTGGGCTAGCGGGCCCCAGG + Intronic
1004517717 6:16334898-16334920 CAACTGGGAATGAGTGCCCTGGG + Intronic
1004609490 6:17225958-17225980 CAACTGGGACAGGGATTCCCTGG - Intergenic
1005495620 6:26385241-26385263 CAACAGGGGCAGCGTGGCCCTGG + Exonic
1005504741 6:26459707-26459729 CAGCAGGGGCAGCGTGGCCCTGG + Exonic
1006298501 6:33180685-33180707 CAACTGGGCCTGGGTTCCCCTGG + Exonic
1006683274 6:35812424-35812446 CAACTGGGGCAGCCAGCCCCAGG - Intronic
1008588601 6:52970839-52970861 CAACTTGGACATCATGTCCCTGG - Intergenic
1016658160 6:146544072-146544094 CAACTGGGACAGCAGGACTCTGG + Exonic
1017036431 6:150271420-150271442 CAGCTGGGTCAGCGTGTTCCTGG - Intergenic
1019357060 7:585984-586006 CCACTGTGTCTGCGTGCCCCTGG - Intronic
1022286208 7:28957657-28957679 CAGCGGGGCCAGCGTGCCCGGGG + Exonic
1025144684 7:56493298-56493320 CAACAGGGACAGAGTGCAGCAGG - Intergenic
1025281343 7:57628037-57628059 CACCTGGGACATCATGCTCCAGG + Intergenic
1025303386 7:57837470-57837492 CACCTGGGACATCATGCTCCAGG - Intergenic
1033977166 7:147116513-147116535 CAGCTGGGACAACCTGCCCTGGG + Intronic
1034353550 7:150433052-150433074 CACCAGGGACACAGTGCCCCTGG - Intergenic
1034421616 7:150993809-150993831 CAACTTGAAGAGCGTGGCCCAGG + Exonic
1035649187 8:1252170-1252192 CGACTGTGACACCGTGACCCAGG - Intergenic
1038006029 8:23431120-23431142 CAACTGGGACAGAATTCCCTTGG + Exonic
1038141140 8:24846514-24846536 AAACTGGGACATCATGCCCTAGG + Intergenic
1039901168 8:41753511-41753533 CAACTGGGACAGCGTGCCCCTGG - Intronic
1045063913 8:98428843-98428865 CAACTTGGGCAGGGTGGCCCAGG + Exonic
1049622336 8:143604314-143604336 CAACTGAGTCAGCCTGCCCTGGG + Exonic
1055535916 9:77244281-77244303 GAACTGAGACAGCGTTCCCTAGG + Intronic
1056749866 9:89340745-89340767 CAAATGGGACACCATGCCTCAGG + Intronic
1057074797 9:92132828-92132850 CAGCTGGGTCAGCCTGACCCTGG - Intergenic
1057202851 9:93152133-93152155 CAACTCTGGCAGCGTGCCCAAGG - Intergenic
1057379433 9:94554758-94554780 CAACAGGGAGGGAGTGCCCCAGG + Intergenic
1058282045 9:103127847-103127869 CAACTGCAACAGGGTGCCCATGG + Intergenic
1060966504 9:127714978-127715000 CAACGGGCGCAGCGTGGCCCGGG - Exonic
1061902557 9:133680468-133680490 CACCTGGGAGCGCGTGGCCCTGG + Intronic
1188524208 X:31071806-31071828 CAACCGGGACGACGTGGCCCTGG - Exonic
1189010717 X:37043548-37043570 CACCTGCGACAGCGGGCCCAGGG + Intergenic
1189037176 X:37505320-37505342 CACCTGCGACAGCGGGCCCAGGG - Intronic
1193301261 X:79891751-79891773 TAACTGGGACAGAGTTCCCGTGG + Intergenic
1199433373 X:147785886-147785908 CACCTAGGATAGGGTGCCCCAGG + Intergenic
1200133275 X:153862830-153862852 CAACGGGGACATCAAGCCCCTGG - Exonic
1200236231 X:154469115-154469137 CAACTGTGACAGCATCACCCAGG + Exonic
1200690645 Y:6304783-6304805 CAACGGGCACAGCCTGGCCCTGG - Intergenic
1201044627 Y:9869933-9869955 CAACGGGCACAGCCTGGCCCTGG + Intergenic