ID: 1039906725

View in Genome Browser
Species Human (GRCh38)
Location 8:41791806-41791828
Sequence GCCTCTGTGGCCCTCCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 328}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039906725_1039906733 5 Left 1039906725 8:41791806-41791828 CCCTGGGGGAGGGCCACAGAGGC 0: 1
1: 0
2: 4
3: 47
4: 328
Right 1039906733 8:41791834-41791856 GCTGCCTTCCAGACACCATGGGG No data
1039906725_1039906731 3 Left 1039906725 8:41791806-41791828 CCCTGGGGGAGGGCCACAGAGGC 0: 1
1: 0
2: 4
3: 47
4: 328
Right 1039906731 8:41791832-41791854 CCGCTGCCTTCCAGACACCATGG No data
1039906725_1039906732 4 Left 1039906725 8:41791806-41791828 CCCTGGGGGAGGGCCACAGAGGC 0: 1
1: 0
2: 4
3: 47
4: 328
Right 1039906732 8:41791833-41791855 CGCTGCCTTCCAGACACCATGGG No data
1039906725_1039906740 28 Left 1039906725 8:41791806-41791828 CCCTGGGGGAGGGCCACAGAGGC 0: 1
1: 0
2: 4
3: 47
4: 328
Right 1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG No data
1039906725_1039906735 7 Left 1039906725 8:41791806-41791828 CCCTGGGGGAGGGCCACAGAGGC 0: 1
1: 0
2: 4
3: 47
4: 328
Right 1039906735 8:41791836-41791858 TGCCTTCCAGACACCATGGGGGG No data
1039906725_1039906734 6 Left 1039906725 8:41791806-41791828 CCCTGGGGGAGGGCCACAGAGGC 0: 1
1: 0
2: 4
3: 47
4: 328
Right 1039906734 8:41791835-41791857 CTGCCTTCCAGACACCATGGGGG No data
1039906725_1039906739 24 Left 1039906725 8:41791806-41791828 CCCTGGGGGAGGGCCACAGAGGC 0: 1
1: 0
2: 4
3: 47
4: 328
Right 1039906739 8:41791853-41791875 GGGGGGCCCAGAGCTTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039906725 Original CRISPR GCCTCTGTGGCCCTCCCCCA GGG (reversed) Intronic
900134989 1:1112820-1112842 GCCCGTCTGGCCCTCCTCCAAGG + Intronic
900244346 1:1630639-1630661 GCCTCTGGGGTCCTCCCCTCGGG + Intergenic
900744901 1:4354396-4354418 GCCTCCATAGCCCTCCTCCAAGG - Intergenic
901629424 1:10641024-10641046 GCCTCTGGGCTCCTCCCACACGG + Intronic
901630831 1:10647417-10647439 TCCTCTGTGGCTCACACCCATGG - Intronic
901934983 1:12620730-12620752 TCCTCTGTTGCCCTCCCCCGAGG + Intergenic
904002168 1:27345049-27345071 TCCTGTGTGGCCCTACCTCAGGG + Exonic
904203679 1:28838531-28838553 GGCTCTGTGTCTCACCCCCATGG + Intronic
905484722 1:38287190-38287212 GCCTCTGTGGGCCTCTTCCCTGG + Intergenic
905632406 1:39525955-39525977 ACCTCTGTGCCCCTCCCCTGGGG + Intergenic
906103822 1:43279788-43279810 GCCTCTGGGGTCCTCCTCCAGGG + Intergenic
907665063 1:56427366-56427388 GCCCCTGTCACCCTCTCCCAAGG + Intergenic
908407008 1:63824530-63824552 GCTTCTGAGACCCTACCCCAGGG - Intronic
911123945 1:94322944-94322966 CACCCTGTGGCCCTCCCACACGG + Intergenic
913133401 1:115863620-115863642 TCCCCTGGGGCCCTCCCTCAGGG - Intergenic
913205249 1:116532639-116532661 GTCTATGGGGCCCTCCCGCAGGG + Intronic
913396647 1:118378768-118378790 GCCTCTCTGTCCCTTGCCCATGG + Intergenic
915450438 1:156001433-156001455 GACCCTGTGTCCCACCCCCAGGG - Intronic
915580190 1:156808813-156808835 GCCTCTCTGGCTCTCTCCCTTGG - Intronic
915732167 1:158061398-158061420 CCCTGTGTTGCCCACCCCCAAGG - Intronic
916405694 1:164495917-164495939 GCCTCTGTGGTCATGCCCCTAGG - Intergenic
918967382 1:191369233-191369255 ACCTCTGTGTCACTCCTCCATGG - Intergenic
919755313 1:201062674-201062696 TGCTCTGGGGCCCTGCCCCAAGG - Intronic
920311139 1:205049015-205049037 GGGTCTGTGGTGCTCCCCCAGGG + Intronic
920341850 1:205280044-205280066 CTCTCTGTCACCCTCCCCCAGGG + Intergenic
922153307 1:223022875-223022897 GCCTCTGTTTGACTCCCCCAGGG + Intergenic
922564636 1:226593698-226593720 GCCTCTCTGGATCTCCCACAGGG + Intronic
922605635 1:226888298-226888320 GCCTCCGTCGCCCTCTCTCATGG + Intronic
922754159 1:228085448-228085470 GGCTCTCAGGTCCTCCCCCAGGG + Intronic
922854932 1:228767027-228767049 GCCTCTGTGGCACTCTCTCAGGG - Intergenic
923817741 1:237399664-237399686 ATCTCTGTGTCACTCCCCCATGG + Intronic
1063848982 10:10163075-10163097 ACCTCTGTGTCACTCCCCCATGG + Intergenic
1065122201 10:22541201-22541223 GGCTCTGCTGTCCTCCCCCATGG - Intronic
1065815382 10:29478570-29478592 GCACCTGTGGCCTTCCCTCAAGG + Intronic
1067042442 10:42962234-42962256 GCCTCTGTGTCCTTCCTCCTGGG + Intergenic
1067238176 10:44469085-44469107 GCAACTGTGGCCCTGCCCCAGGG + Intergenic
1069107593 10:64402439-64402461 GCTTCTGTGGCCCTGCTCCTTGG + Intergenic
1069657689 10:70102204-70102226 CCCTCTGTGTCCCACCCCCAAGG - Intronic
1069661013 10:70123519-70123541 TCTTCTGTGTCCCTTCCCCAGGG - Exonic
1070479850 10:76871212-76871234 GCCTGTGTGGCCTTCCCTCACGG + Intronic
1070557786 10:77542517-77542539 ATTTCTGTGGCCCTCCCCTAAGG + Intronic
1072015048 10:91338315-91338337 ACCTCTGTGGCTCTGCCCCAGGG - Intergenic
1074828662 10:117232752-117232774 GCTTCTGGGTCCCTCCCCCTGGG - Intergenic
1075327713 10:121547846-121547868 CCACCTGTGGGCCTCCCCCATGG - Intronic
1075649464 10:124118245-124118267 GGCCCTGTGGCCCTCCACCCTGG + Intergenic
1076232605 10:128834422-128834444 GCCCCTGGGGCCCACCCTCATGG - Intergenic
1076511623 10:131018202-131018224 TGCCCTGTGGCCCTCCCCTAGGG - Intergenic
1076793771 10:132789258-132789280 CCCTCTGTGGGCCCCACCCACGG + Intergenic
1076822418 10:132946128-132946150 GCATGTGTGGCCCTCCCCTGTGG + Intergenic
1076906805 10:133366643-133366665 GTTTCTGTGGGGCTCCCCCATGG + Intronic
1077825463 11:5804270-5804292 ACTTCTGTGTCACTCCCCCATGG + Intronic
1077826080 11:5809298-5809320 ACTTCTGTGTCACTCCCCCATGG + Intronic
1078446705 11:11410069-11410091 GGCTCCCTGGCCCTCCCACAGGG + Intronic
1078907531 11:15701794-15701816 GCCTCTGTGGCAAGCCCCCCTGG + Intergenic
1082101592 11:48177351-48177373 ATCTCTGTGTCACTCCCCCATGG + Intergenic
1083376216 11:62224023-62224045 ACCTCTGTGTCACTCTCCCATGG - Intergenic
1083679418 11:64344345-64344367 GCCTCTGTGGCCCCACCTCAGGG + Exonic
1084446421 11:69206139-69206161 GCCTCTGTCGCCCGCTCCCTGGG - Intergenic
1084605620 11:70170049-70170071 GCCCCTGCGGCCCTCCCCCTGGG - Intronic
1085383224 11:76139423-76139445 GCATCTGTCTCCCTACCCCAAGG + Intronic
1085981924 11:81735577-81735599 GCCTCTCTGGGCTACCCCCATGG + Intergenic
1086127847 11:83367870-83367892 ACCTCTGTGTCACTCCCTCATGG - Intergenic
1087098032 11:94338655-94338677 ACCTGTGTGGCCCTCCCCGATGG - Intergenic
1089464443 11:118675616-118675638 GCTTCTGTGTCCTTTCCCCATGG + Intronic
1091296669 11:134478523-134478545 GTCTCTGTGGCCGTCCCCTCTGG - Intergenic
1091400367 12:177467-177489 ACCTCAGTGCCCCTGCCCCAGGG + Exonic
1092077154 12:5683504-5683526 GACTCCATGGCCCTCCTCCAAGG - Intronic
1094493741 12:30976870-30976892 CTCTGTGTGCCCCTCCCCCAGGG - Intronic
1096496406 12:52041800-52041822 CCCTCTGTAGGCCTCCACCATGG + Exonic
1096561591 12:52439525-52439547 GCCTCTGGGTCCCTACCCCGAGG - Intergenic
1096628539 12:52910502-52910524 GTCTCTGTGGCCCTGGCCAACGG - Intronic
1096868324 12:54578167-54578189 GCATCTCTGACCCTTCCCCAAGG - Exonic
1096984061 12:55744882-55744904 GTCCCAGTGGCCCACCCCCATGG + Intronic
1098148041 12:67517500-67517522 ACCTCTGTGGTCTTCCCCCTTGG - Intergenic
1100367480 12:93935086-93935108 GCTCCTGTGGCCCCCACCCAGGG + Intergenic
1101878149 12:108608877-108608899 CCCGATGTGGCCCTTCCCCATGG - Intergenic
1102112598 12:110376028-110376050 TCCTCAGTGGCCTTCCCCCAAGG + Intronic
1102593738 12:113976679-113976701 ACCTCTGTGGTCATCCCCCCGGG + Intergenic
1103851151 12:123934402-123934424 GACCCTGTGGCCCTGCCCCATGG - Exonic
1103851818 12:123938405-123938427 GCCTCTGTGGCTCTTACCCTTGG + Intronic
1107566138 13:41606717-41606739 GCCTCTGGCGCTCTCCCCCATGG - Intronic
1110410322 13:75197855-75197877 GCCTCTGTGTTGCTCCTCCAGGG - Intergenic
1114064582 14:19050658-19050680 GCCTCTGTGAACCTCCCACCTGG + Intergenic
1114097679 14:19349344-19349366 GCCTCTGTGAACCTCCCACCTGG - Intergenic
1117479696 14:56130139-56130161 CCCTCTGGGGACCTCCCCCAAGG - Intronic
1118468931 14:66056878-66056900 GCCTCTTTGCCCATCCCCCTAGG - Intergenic
1119498860 14:75105452-75105474 GCCTCTGTGAGCCTCTCACAGGG + Intronic
1121051603 14:90822552-90822574 GGCTCTGTGCCCCTCCCCCTTGG + Intergenic
1122297208 14:100712293-100712315 GCCTCTGTGGCCCTGAGGCAGGG - Intergenic
1202854749 14_GL000225v1_random:43393-43415 GCGCCTGTGGCTCTCCCACAGGG + Intergenic
1202857155 14_GL000225v1_random:58684-58706 GCCCCTGGGGCTCTCCCACAGGG + Intergenic
1124377735 15:29139369-29139391 GCGTCTGTGGTCCTCCGCCTTGG + Intronic
1125532277 15:40421510-40421532 GGTTCTGTTGCCCTCCCACAGGG - Intronic
1125553877 15:40568409-40568431 GTCTCTGTGTCCCTCTTCCAAGG - Intergenic
1127715659 15:61646748-61646770 GCCTCTGTGGACTTCACACATGG + Intergenic
1129339572 15:74876383-74876405 GCCTCTATGGCCACCCCTCAAGG + Intergenic
1131119860 15:89815130-89815152 GGCTCTGAGCCCCTCCCCCGCGG - Intronic
1131232170 15:90667217-90667239 GTCTCTGGGGCACTTCCCCACGG + Intergenic
1131382177 15:91973144-91973166 GCCTCAGTTCCCCTGCCCCAGGG - Intronic
1131491853 15:92870009-92870031 GGCTCTGTGCCCATCCCACAGGG - Intergenic
1132064339 15:98718285-98718307 GCCTCTGTTCCCATCCCACATGG - Intronic
1132747483 16:1443052-1443074 GCCCCTGTGGCCACCTCCCATGG + Intronic
1133110976 16:3548267-3548289 GCCTCCTTGGCTCTGCCCCAGGG - Intronic
1134171530 16:11973507-11973529 CACTCTGTGGTTCTCCCCCAGGG - Intronic
1134352254 16:13448559-13448581 CCATCTGTGGCCCTGCCCCAAGG + Intergenic
1135776037 16:25258030-25258052 CCCTCTGTGTCCCTCCGCCCCGG - Intergenic
1136993204 16:35169721-35169743 GCCTATGTAGCCATCCCGCATGG + Intergenic
1137406121 16:48190824-48190846 GTCACTGTGGCCCTCCATCAGGG + Intronic
1137434072 16:48441361-48441383 GCCTCTCTGTCCTTCCCCCAGGG + Intronic
1141628737 16:85275591-85275613 TCCTCTCTGGGCCACCCCCAGGG + Intergenic
1141649935 16:85387407-85387429 TGCTCTGTGGTCCTGCCCCAGGG + Intergenic
1142222885 16:88864176-88864198 GCCCCTGATGCCCTCCACCATGG + Intronic
1142225659 16:88876373-88876395 CCAGCTGTGCCCCTCCCCCAGGG - Exonic
1142233681 16:88911461-88911483 CCCTCTGTGGCCCTGCCACGGGG + Intronic
1142265973 16:89064095-89064117 TCCTCTGTGCCCCTCCCCACAGG - Intergenic
1142637914 17:1269402-1269424 GCCTCTGTCCTCTTCCCCCAGGG - Intergenic
1142903260 17:3026442-3026464 CCCACTGTCGCCCTCCTCCATGG - Exonic
1144882765 17:18439044-18439066 GCCCCACTGGCCCTTCCCCAAGG - Intergenic
1145771049 17:27493478-27493500 GCCTGTGTGACCCTGCCCCGTGG + Intronic
1145779280 17:27551726-27551748 GGCCCTGTGGCTCTCCCCCAAGG + Intronic
1146649383 17:34597290-34597312 GCCCCTGGAGCCCTGCCCCAAGG - Intronic
1147165937 17:38593352-38593374 TCCTCTGTGGCCCAGCGCCATGG - Intronic
1147187913 17:38722614-38722636 GTTTCCCTGGCCCTCCCCCATGG + Intronic
1148783678 17:50135078-50135100 GCCTCTGTGCCTCAGCCCCATGG + Exonic
1148850629 17:50553298-50553320 TCCTCTGTGGTTCTCTCCCAAGG - Intronic
1149412934 17:56427611-56427633 GCCTCTGTCCCCTTTCCCCAGGG - Intronic
1149626840 17:58085481-58085503 CCCTCTGTGGCCCAGCCCAATGG - Intronic
1150327007 17:64265303-64265325 GCTTCTGTTGCCCTTCCCAAAGG + Intergenic
1150387739 17:64774419-64774441 GCCTCTGAGACTCTTCCCCATGG - Intergenic
1150613178 17:66749630-66749652 GCTGCTGTGCCCCTACCCCAGGG + Intronic
1150632865 17:66892279-66892301 GCCTCTGAGCCCTTTCCCCAAGG + Intergenic
1151974058 17:77474529-77474551 CCCTCAGTTGCTCTCCCCCAGGG - Intronic
1152278349 17:79371173-79371195 GCCACTGTGGCCCCTCGCCATGG - Intronic
1152462205 17:80447309-80447331 GGCTCTGGGCCCCTCCCCCCAGG - Intergenic
1152541644 17:80979702-80979724 GCCTCAGTGGCCCCCCTCCTGGG + Intergenic
1153775661 18:8451182-8451204 GCCTCTGTGGCCCTGACTCCTGG - Intergenic
1157948181 18:52004639-52004661 GACTCTCTTGCCCTCCCTCATGG - Intergenic
1158454097 18:57591511-57591533 GCCTCTGCGGCCCTGCTTCATGG + Intergenic
1158579736 18:58671299-58671321 GCCTCCCTCGCCCTCCCCCGCGG - Intergenic
1160243034 18:77136556-77136578 GCCTCTGAGCCCCTCCCTCCAGG - Intergenic
1160515962 18:79479365-79479387 GCCTGTGCGGCCCCCCTCCACGG + Intronic
1160862975 19:1245398-1245420 GCCAGTGTTGCCCGCCCCCAGGG - Intergenic
1160984801 19:1833612-1833634 GCCTCCGCAGCCCTCCCCCTGGG - Intronic
1161124930 19:2550557-2550579 GCTTCTGTGACTGTCCCCCAGGG + Intronic
1161577838 19:5064691-5064713 GACTCTGTGGCCCTCACCTCTGG - Intronic
1162735810 19:12746417-12746439 GCCACTGTGCCCAGCCCCCATGG + Intronic
1163057149 19:14728891-14728913 GCCTCCATGTCCTTCCCCCATGG + Intronic
1163258637 19:16173231-16173253 GCCTCTGGGGCCTCCTCCCACGG + Intronic
1163857581 19:19716924-19716946 GCTTCTGTGTCCCTGCCCCCAGG - Intronic
1163878869 19:19900440-19900462 TCCTCTGTGTTACTCCCCCATGG - Intergenic
1166094556 19:40530739-40530761 GCGTCCTTGCCCCTCCCCCAGGG - Intronic
1166827982 19:45621282-45621304 GTCTCCGTGGCCCTCTGCCACGG + Exonic
1166855703 19:45781805-45781827 GGCTCTATGGCCCTCTCCCCTGG - Intronic
1167156746 19:47743332-47743354 GACTCTGGGGCCCTCCCCCCGGG + Intergenic
1167693403 19:51000942-51000964 GCCTCTGTGGGCTTTCCTCAGGG - Intronic
1168189694 19:54728715-54728737 GTCTTTGTGCCCCTCCCTCAGGG - Intronic
1168201814 19:54820782-54820804 GTCTTTGTGTCCCTCCCTCAGGG - Intronic
1168206620 19:54854820-54854842 GTCTTTGTGCCCCTCCCTCAGGG - Intronic
1168588781 19:57615644-57615666 TCCTCTGTGTCACTCCCCCATGG + Intronic
925283856 2:2703453-2703475 GCCCCTGTGGCCTTCCCCTGTGG + Intergenic
925333363 2:3075552-3075574 GGCTCTGAGGCCCGCCCCCGTGG + Intergenic
925498711 2:4481036-4481058 ATCTCTGTGTCACTCCCCCATGG + Intergenic
926087062 2:10027229-10027251 TTCTCTGTGGCCTTCCCCAAAGG - Intergenic
927336090 2:21926204-21926226 GCCTCTGTGTCAGTCCCTCAGGG + Intergenic
927645426 2:24874170-24874192 GCCTCTGTGGCACTCAACAAGGG + Intronic
927922448 2:26983516-26983538 GCCTCTGAGGCCCTCTCGAAGGG + Intronic
927928351 2:27028076-27028098 TCTTCTGTGGCCCCACCCCATGG + Intergenic
930013441 2:46955323-46955345 TCATCTGTGGCCCTGGCCCAGGG + Intronic
931254355 2:60556843-60556865 GCCCCTGGTGCCCTCCCCTAGGG + Intergenic
934714078 2:96533272-96533294 CCCTCCGTTCCCCTCCCCCAGGG + Intergenic
935194207 2:100802374-100802396 GCCTTTGAGTCCATCCCCCAGGG + Intergenic
935222052 2:101023522-101023544 ACCTCTGGGGCCCTCCCCACAGG - Intronic
936286583 2:111185960-111185982 GCCTCTCTCGCTCTTCCCCAGGG - Intergenic
937231944 2:120403347-120403369 GCCTCTAGAGGCCTCCCCCAGGG + Intergenic
938369838 2:130762189-130762211 GCCTCTGTTGCCCTCCTGGAAGG - Exonic
938378982 2:130826047-130826069 TCCTCGGGGGCCCTGCCCCACGG + Intergenic
939040354 2:137181725-137181747 GCATCTCTGGCACTCCCCCATGG + Intronic
939658013 2:144851933-144851955 GCCTCTGTAGCCCTACACAAGGG + Intergenic
939788337 2:146543363-146543385 ACCTCTATGTCACTCCCCCATGG + Intergenic
942070758 2:172313382-172313404 GCCTCTCTTGACCACCCCCACGG - Intergenic
946043918 2:216805135-216805157 GGCTCTGAGTCCCTGCCCCAGGG + Intergenic
946331283 2:219010492-219010514 GGCTCTGAGGCTCTCCCACAAGG + Intronic
947361692 2:229351839-229351861 CTCTCTGTGACTCTCCCCCAAGG + Intergenic
947451261 2:230211259-230211281 GCCTCCTTTGCCCTCCCCCAGGG + Intronic
947500079 2:230665208-230665230 GCCTCGGAGGCCCTTCCCCCTGG + Intergenic
948040264 2:234896091-234896113 GCCTCTGTGCCTCTCTCCCAGGG - Intergenic
948728009 2:239946453-239946475 GCCTCCGGGGCCCTCCCCGCAGG + Intronic
1170982394 20:21226852-21226874 GCCTCTGTGGCCCTTCTCCAAGG - Intronic
1171310788 20:24143186-24143208 TCCTCCCTGGCACTCCCCCACGG + Intergenic
1171824213 20:29879251-29879273 GCCCCTGGGGCTCTCCCACAGGG - Intergenic
1172603690 20:36200602-36200624 GCCCCAGTGCCCTTCCCCCATGG - Intronic
1172618533 20:36305919-36305941 GCCTCAGTTTCCCTCCTCCACGG + Intergenic
1172621329 20:36320176-36320198 CCCTCTGTGCCCCTCTCCCCCGG + Intronic
1172961841 20:38805651-38805673 GCCTCTCGGCTCCTCCCCCAAGG - Intergenic
1174524629 20:51161079-51161101 GCCTCTGTGTCCCTGAACCATGG - Intergenic
1174737965 20:52983891-52983913 GCAACTCTGTCCCTCCCCCACGG + Intronic
1175357708 20:58381970-58381992 GCTTCTGTCGCCCTCCCCCATGG - Intergenic
1175486979 20:59353720-59353742 GGCACTGTGGGACTCCCCCAGGG - Intergenic
1175524093 20:59621659-59621681 GCCTCAGTGGCCTTCCCTGAAGG + Intronic
1175561380 20:59933530-59933552 GCCTGGGTGGGCTTCCCCCACGG - Intronic
1175773027 20:61635611-61635633 GCCTCTGTTGCCCGGCCCCTGGG - Intronic
1175780724 20:61680379-61680401 GCCTCCGTGACCTTGCCCCAAGG + Intronic
1175810492 20:61854909-61854931 GCGCCTTTGGCCCACCCCCAGGG + Intronic
1175810505 20:61854955-61854977 GCGCCTTTGGCCCACCCCCAGGG + Intronic
1175810544 20:61855093-61855115 GCGCCTTTGGCCCACCCCCAGGG + Intronic
1175880704 20:62257130-62257152 GTCTCTATGGCCATGCCCCAAGG + Intronic
1175921663 20:62453122-62453144 GCCTCAGTGGCCAAGCCCCAGGG - Intergenic
1176113823 20:63422498-63422520 GCCTCCCACGCCCTCCCCCACGG - Intronic
1176295706 21:5071019-5071041 GCCACAGTGGCCCTATCCCATGG - Intergenic
1176623558 21:9073952-9073974 GCCTCTGTGTCCCACCCTTAGGG + Intergenic
1178351221 21:31873952-31873974 GCCCCTGTGCCCCAGCCCCACGG - Intronic
1178704751 21:34864141-34864163 CTCTCTGTGGCCCCACCCCATGG + Intronic
1179800823 21:43810825-43810847 CCCTCTCTGTGCCTCCCCCAGGG + Intergenic
1179861341 21:44191105-44191127 GCCACGGTGGCCCTATCCCATGG + Intergenic
1180483072 22:15773280-15773302 GCCTCTGTGAACCTCCCACCTGG + Intergenic
1180737078 22:18025079-18025101 GCAACTGTAGCCCTCCCCCAGGG - Intergenic
1181021168 22:20103937-20103959 GCGTCTGTGGTGCTCCCACACGG + Intronic
1181307551 22:21925552-21925574 GCCTCTTTGGCTCTCACCGATGG + Exonic
1181597400 22:23925293-23925315 ACCTCTGTGTCACTCCCCCATGG - Intergenic
1182472969 22:30559989-30560011 GTGTGTGTGACCCTCCCCCAGGG - Intronic
1183035080 22:35135144-35135166 GCCACCCTGCCCCTCCCCCAGGG + Intergenic
1183279003 22:36922335-36922357 TACGCTGCGGCCCTCCCCCAGGG - Intronic
1183720529 22:39559224-39559246 GGATCTGTGGCCCAGCCCCAGGG + Intergenic
950043050 3:9932729-9932751 GCCACTCTGGTCCTCCCCCAGGG - Intronic
950569718 3:13792491-13792513 ACCTCTGTGTGCCTCCCCCGTGG + Intergenic
950678582 3:14569431-14569453 GCCTCCCTGGGACTCCCCCAAGG - Intergenic
952307175 3:32156538-32156560 CCCTCTCTTGCCCTCTCCCACGG - Intronic
952557120 3:34544910-34544932 GCCTCTGGGTCCCACCCCAATGG + Intergenic
953690344 3:45112533-45112555 GACTCTTTGGGGCTCCCCCAAGG + Intronic
954090260 3:48278628-48278650 ATCTCTGTGTCACTCCCCCATGG - Intronic
954419502 3:50411163-50411185 ACCTGTCTGGCCCTCACCCAGGG + Intronic
954656631 3:52198031-52198053 GCCTCTCTGCCCCGCCCCCCCGG + Intergenic
954846490 3:53563189-53563211 TCCTCTGTCCCCCTCCCACAGGG + Intronic
957432195 3:80124855-80124877 GCCTCTCTGCGCCTCCCTCATGG + Intergenic
957893516 3:86389763-86389785 ATCTCTGTGTCACTCCCCCATGG + Intergenic
958018600 3:87970490-87970512 CCCTGTGTGGCCCTCGCTCAGGG - Intergenic
959177054 3:102926717-102926739 ACCTCTGTGTCACTCCCCCATGG + Intergenic
960659113 3:120039711-120039733 ACCTCTGTGTCACTCCCGCATGG - Intronic
961386024 3:126524012-126524034 GCCTCTGGGCCCCGCCCCTAGGG - Intergenic
961410026 3:126713596-126713618 GACTCTGTGGTCCCCTCCCAGGG + Intronic
961513326 3:127417886-127417908 GCCTCTGGGGGCCTCCTACATGG + Intergenic
962015265 3:131432331-131432353 GCCCCTGTGGCCCCCACCAATGG - Intergenic
963745266 3:149118888-149118910 GCACATGTGGCCATCCCCCAAGG - Intergenic
963749013 3:149155641-149155663 CCCTCTGGGTCCCTCCCCCCAGG - Intronic
964611785 3:158623148-158623170 ATCTCTGTGTCACTCCCCCATGG + Intergenic
965323517 3:167274828-167274850 ATCTCTGTGTCCTTCCCCCATGG - Intronic
966522511 3:180889269-180889291 ACCTCTGTGTCACTCCCCAATGG + Intronic
968092462 3:195907777-195907799 GCCTCTGTGGCCCCACCCTGGGG - Intronic
968615188 4:1574611-1574633 TCCTCTGTGGCCCTCAGCCAAGG + Intergenic
970398332 4:15694131-15694153 ACTTCTGTGTCCCTCCCCCATGG + Intronic
977246429 4:94637035-94637057 GCCTCTGTGACCCTCAGCCAAGG - Intronic
977601402 4:98937293-98937315 ACCTCTTTGTCCCTCCCCGATGG - Intergenic
978767846 4:112422805-112422827 ACAGCTGAGGCCCTCCCCCAAGG - Intronic
979958710 4:126989531-126989553 GCCCCTGGGGCACTGCCCCAGGG + Intergenic
981076976 4:140601992-140602014 ACCTCTGTGTCTCTTCCCCATGG + Intergenic
982822936 4:159966891-159966913 GCCTCGGTGCCCTACCCCCAGGG - Intergenic
985802377 5:2013164-2013186 GTCTCTGTGGCGCTCACCCCAGG - Intergenic
985885707 5:2676133-2676155 GGCTCTGGGACCCTCCCCCATGG - Intergenic
986285281 5:6354423-6354445 GCCTCTGCCTCCCTCTCCCAAGG - Intergenic
987045465 5:14103456-14103478 ACTTCTGTGTCCCTCCCCCATGG - Intergenic
989491789 5:42064399-42064421 GGTTCTGTGGCCTTCCCACATGG + Intergenic
992990449 5:82278191-82278213 GCTTCCCCGGCCCTCCCCCATGG + Intronic
997319179 5:132963691-132963713 GCCTCTGCGCCCCTCCCCGCTGG + Intergenic
997387351 5:133483826-133483848 GCCTCCTTGGCTCTCACCCAGGG + Intronic
998817921 5:146032322-146032344 GACTCTGTGGCCAAGCCCCATGG + Intronic
999273065 5:150309311-150309333 GCCTCTGGGGCCCACTGCCAGGG - Intronic
999997535 5:157106506-157106528 GTCTTAGTGGCCCTCCTCCAGGG + Intronic
1002643849 5:180643476-180643498 GCCTCAATGGCTCTCCCCCCGGG + Intronic
1002644821 5:180647976-180647998 CCCTCTGGGCCCCTCCTCCAGGG + Intronic
1002898521 6:1392795-1392817 GCCTCTGTGCCCCTACCCAGCGG + Intronic
1002939594 6:1704382-1704404 CTCTCTGTTGCCCACCCCCATGG - Intronic
1007593753 6:43038949-43038971 GCCTCTGTGAGCCTCGCTCAAGG + Exonic
1007695724 6:43733320-43733342 TCCACTGTGCCCCTCCTCCAGGG + Intergenic
1007966862 6:46011387-46011409 GACTCAGTGGCTCTCCACCAGGG + Intronic
1010478472 6:76319440-76319462 GCCTTTGTGGACGTCCCCCCTGG - Intergenic
1011211733 6:84963026-84963048 ACTTCTGTGCCACTCCCCCATGG + Intergenic
1012450611 6:99349691-99349713 GCCTCTGTTTCCCTGCCCCGGGG - Intronic
1016699689 6:147039929-147039951 GTGTCTGTGGACCTCCCTCAAGG - Intergenic
1017919479 6:158858696-158858718 GCCTGTGTGCCCCTCTTCCAAGG + Intergenic
1018942768 6:168319960-168319982 GCCTCTTTGCCCCTCTCCCCCGG - Intergenic
1019328995 7:453431-453453 GCCTCTGGGGCCTTTCCCCAGGG - Intergenic
1019515832 7:1439868-1439890 GCCTAGCTGGCCCTCCCCCTTGG - Intronic
1023873629 7:44275739-44275761 TCCTAGGTGGCCCTCCCCCTGGG + Intronic
1024095506 7:45979486-45979508 GCATCTGTGGTCCTCCTCAAGGG + Intergenic
1024810649 7:53207522-53207544 GCCTCTGTGCTAGTCCCCCAGGG - Intergenic
1025875219 7:65475559-65475581 GCCCCTCTGTCCCTCCTCCAGGG + Intergenic
1026692568 7:72562088-72562110 ACCTCTGTGTTACTCCCCCATGG - Intronic
1027422548 7:78031494-78031516 GCCTCTGTGTCCCTCACCATTGG + Intronic
1028018878 7:85746063-85746085 ACCTCTGTGCCACTCTCCCATGG + Intergenic
1029536861 7:101162454-101162476 GCCTGTGTGGTCCTTCCCAAGGG - Intergenic
1029730274 7:102433889-102433911 GCATCCCTGTCCCTCCCCCAGGG - Intronic
1030005422 7:105113202-105113224 GGCTCTGTGGCCCTGCCACATGG + Exonic
1030330534 7:108265292-108265314 ACCAGTGTAGCCCTCCCCCAGGG - Intronic
1031986056 7:128165549-128165571 GCCTGTTTGGCCCTCTCTCATGG - Intergenic
1032074727 7:128831037-128831059 GCACCTGTGCCCCTGCCCCATGG - Intronic
1032441964 7:131948802-131948824 ACCTCTGTGTCCCTGCTCCAAGG + Intergenic
1032744333 7:134770820-134770842 GCCTCTTTAAGCCTCCCCCATGG + Intronic
1034827070 7:154275299-154275321 CCCTCTGTGTCCCCTCCCCATGG + Intronic
1034934001 7:155186822-155186844 ACCTCTGAGGCCCTTCCCCTAGG - Intergenic
1035051633 7:156002144-156002166 GCTGCTGTGGCCCGCTCCCACGG - Intergenic
1035306389 7:157935769-157935791 GCATCTGTGTCACTCCCTCAGGG + Intronic
1035306398 7:157935809-157935831 GCATCTGTGTCACTCCCTCAGGG + Intronic
1035306407 7:157935849-157935871 GCATCTGTGTCGCTCCCTCAGGG + Intronic
1035306416 7:157935889-157935911 GCATCTGTGTCGCTCCCTCAGGG + Intronic
1035306425 7:157935929-157935951 GCATCTGTGTCGCTCCCTCAGGG + Intronic
1035306432 7:157935969-157935991 GCATCTGTGTCGCTCCCTCAGGG + Intronic
1035306440 7:157936010-157936032 GCATCTGTGTCGCTCCCTCAGGG + Intronic
1035367397 7:158358017-158358039 CTCTCTCTGGCCCTCCCACAAGG + Intronic
1035605436 8:927071-927093 GCCACTGGGGCCCTCCCACGAGG - Intergenic
1036788002 8:11700718-11700740 GCCTCTGCGGCCCTGCCGCGAGG - Intronic
1037638406 8:20720854-20720876 GGCTGTGTGACCCTCCCACAAGG + Intergenic
1037663692 8:20949167-20949189 CCTTCTGTGGCCCTCCCCACAGG + Intergenic
1037905957 8:22716166-22716188 GCCTCTGTGTCCCAGCCACAGGG - Intronic
1039468817 8:37801367-37801389 GCCTTTGTGGGCCTCCCCCAGGG + Intronic
1039906725 8:41791806-41791828 GCCTCTGTGGCCCTCCCCCAGGG - Intronic
1040408654 8:47133639-47133661 GGCTCTGTGACCCTCCTGCAGGG + Intergenic
1040638374 8:49302390-49302412 GACTCTGTGGCACTATCCCAAGG + Intergenic
1041359861 8:57041725-57041747 ACCTCTGTGTCCCTCCCGCATGG + Intergenic
1042514870 8:69648479-69648501 GCCTCTCTGGCCGTTCCCCTGGG - Intronic
1042867093 8:73365747-73365769 ACCTCTGTTGGCCTCCGCCACGG - Intergenic
1049558490 8:143295839-143295861 CCCTCTGTGGCCCTCTCCCTCGG - Exonic
1049688137 8:143947193-143947215 CCCTCTGTGGCCCTGCGTCAAGG - Intronic
1049707204 8:144048470-144048492 GGCCTTGTGGCCCTACCCCATGG - Intergenic
1049781422 8:144430707-144430729 GCCACTGTGGCCCTGACCCCTGG - Intronic
1049821292 8:144635252-144635274 GCCTCTTTCGCCTCCCCCCATGG - Intergenic
1049831884 8:144705884-144705906 GCCTCTGTGGCCCTCAGCCAGGG + Intergenic
1051250212 9:15151624-15151646 TTCTCTGTGGCCCTCCCAGAAGG + Intergenic
1051733281 9:20170401-20170423 ACCTCGGTGTCCCTCCCCCATGG + Intergenic
1053131568 9:35618506-35618528 GCCCCTCTGGCCCTGGCCCAGGG - Intronic
1053758204 9:41331932-41331954 TCCTCTGTTTCCCTGCCCCATGG + Intergenic
1054812429 9:69445614-69445636 GCCTCTGTGGTCCTGCCCTCTGG - Intronic
1054858401 9:69925482-69925504 ACATCTGTGTCACTCCCCCATGG + Intergenic
1054859446 9:69933772-69933794 ACCTCTGTGTCACTCCCCCATGG + Intergenic
1056599762 9:88037581-88037603 ACCTCTGTGTCACTCCCCCAGGG + Intergenic
1056600695 9:88044482-88044504 ACCTCTGTGTCACTACCCCAGGG + Intergenic
1057168609 9:92947470-92947492 GCCTCCCTGGCCCGCCCCGAAGG - Exonic
1057211383 9:93202790-93202812 GCCTCAGTGTCCCTGCCCCAGGG - Intronic
1057955289 9:99402555-99402577 GCCCCTGTGGCCTTCCCCAGAGG - Intergenic
1058702834 9:107614887-107614909 GCCTCTGGCGCCTTCCGCCAGGG - Intergenic
1058705972 9:107638018-107638040 GCCTCGCTGGCCCTCCGCCTGGG - Intergenic
1059330513 9:113532590-113532612 CCCTCTGCTGCCCTGCCCCATGG - Intronic
1060330900 9:122669424-122669446 ACCTCTGTGTCACTCCGCCATGG + Intergenic
1060519842 9:124288065-124288087 GCCTCTCTCGCCCTCCCAAAAGG + Intronic
1061238147 9:129353872-129353894 AACTTTGTGGCCCTCCCCAAAGG + Intergenic
1061264551 9:129497505-129497527 GCCTCCTTGCCCCTCCCCTAGGG - Intergenic
1061406673 9:130396149-130396171 CCCTCTGTGCCCCTCCCCAGCGG + Intronic
1061543007 9:131288494-131288516 GCCTGGGTGCCCATCCCCCATGG + Intergenic
1061547484 9:131313182-131313204 GACTCTGTGGGCCTCACCCTGGG + Intergenic
1061863202 9:133478447-133478469 GTCTCTGAGTCCCTCCTCCAGGG + Intronic
1062002204 9:134221995-134222017 TCCTCTGTGGCCCTGGGCCATGG + Intergenic
1062029516 9:134355936-134355958 CCCTCAGCTGCCCTCCCCCAGGG - Intronic
1062213854 9:135378578-135378600 GCCTGTGTGTCCCTCCCACTGGG + Intergenic
1203746742 Un_GL000218v1:44380-44402 GCCTCTGTGTCCCACCCTTAGGG + Intergenic
1203563362 Un_KI270744v1:75100-75122 GCCTCTGTGTCCCACCCTTAGGG - Intergenic
1185734797 X:2488671-2488693 GCCGCTGACGCCATCCCCCAAGG + Exonic
1187960125 X:24560145-24560167 GCCTTTGTGCCCCTGCTCCATGG - Intronic
1189073367 X:37888469-37888491 GCCACTGTGCCCGGCCCCCAAGG - Intronic
1189114354 X:38327588-38327610 GCCTCCGTTCCCCTCCCCAACGG - Intronic
1189262861 X:39690089-39690111 GCCAGTGTGGGGCTCCCCCATGG - Intergenic
1189277470 X:39797349-39797371 GCCACCCTGACCCTCCCCCAGGG - Intergenic
1189730616 X:44016487-44016509 ACATCTGTGGCCCTGCCCCATGG + Intergenic
1189792736 X:44619242-44619264 CCCTCTGTCCCCTTCCCCCAAGG + Intergenic
1190620295 X:52280833-52280855 ACCTCTGTGTCACTCCCCCATGG + Intergenic
1190916018 X:54811666-54811688 CCCACTGTGCCCATCCCCCAGGG - Intronic
1191256040 X:58280045-58280067 GCCTTTGTGCCCATCCCACATGG - Intergenic
1192150376 X:68708635-68708657 TCATCTGGGCCCCTCCCCCAGGG + Intronic
1192314936 X:70044034-70044056 CCCACTGTGGGCCTGCCCCAGGG + Intronic
1194044428 X:88984245-88984267 ACCTCTGTGTCACTCCCCCATGG + Intergenic
1194117661 X:89922556-89922578 GCCCCTGTGGCCCTTGCCAAAGG + Exonic
1198157302 X:133973840-133973862 GCTCCTCTGTCCCTCCCCCAGGG - Intronic
1198619452 X:138490205-138490227 TCCACAGTGGCCCTCCTCCATGG + Intergenic
1199223217 X:145340898-145340920 GCCTCTCTGGAACTACCCCAAGG + Intergenic
1199584245 X:149396401-149396423 ACTTCTGTGTCCCTCCCCCATGG - Intergenic
1200228640 X:154433010-154433032 CTCTCTGTGGCCCCCACCCAAGG - Intronic
1200470446 Y:3579714-3579736 GCCCCTGTGGCCCTTGCCAAAGG + Exonic
1200785618 Y:7257943-7257965 ATCTCTGTGTCACTCCCCCATGG + Intergenic
1201160071 Y:11159394-11159416 GCCTCTGTGTCCCACCCTTAGGG + Intergenic
1201362049 Y:13163211-13163233 ACCTCTGTGTCACTTCCCCATGG + Intergenic
1201895270 Y:18985980-18986002 CCCTCTGTGGCCCCCACCCAAGG + Intergenic
1201940371 Y:19452325-19452347 GCCTCTGTGTCACTCCCCCCTGG - Intergenic