ID: 1039906727

View in Genome Browser
Species Human (GRCh38)
Location 8:41791819-41791841
Sequence AAGGCAGCGGGGAGCCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 8, 3: 33, 4: 328}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039906727_1039906739 11 Left 1039906727 8:41791819-41791841 CCACAGAGGCTCCCCGCTGCCTT 0: 1
1: 0
2: 8
3: 33
4: 328
Right 1039906739 8:41791853-41791875 GGGGGGCCCAGAGCTTTCTCAGG No data
1039906727_1039906740 15 Left 1039906727 8:41791819-41791841 CCACAGAGGCTCCCCGCTGCCTT 0: 1
1: 0
2: 8
3: 33
4: 328
Right 1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG No data
1039906727_1039906733 -8 Left 1039906727 8:41791819-41791841 CCACAGAGGCTCCCCGCTGCCTT 0: 1
1: 0
2: 8
3: 33
4: 328
Right 1039906733 8:41791834-41791856 GCTGCCTTCCAGACACCATGGGG No data
1039906727_1039906734 -7 Left 1039906727 8:41791819-41791841 CCACAGAGGCTCCCCGCTGCCTT 0: 1
1: 0
2: 8
3: 33
4: 328
Right 1039906734 8:41791835-41791857 CTGCCTTCCAGACACCATGGGGG No data
1039906727_1039906735 -6 Left 1039906727 8:41791819-41791841 CCACAGAGGCTCCCCGCTGCCTT 0: 1
1: 0
2: 8
3: 33
4: 328
Right 1039906735 8:41791836-41791858 TGCCTTCCAGACACCATGGGGGG No data
1039906727_1039906731 -10 Left 1039906727 8:41791819-41791841 CCACAGAGGCTCCCCGCTGCCTT 0: 1
1: 0
2: 8
3: 33
4: 328
Right 1039906731 8:41791832-41791854 CCGCTGCCTTCCAGACACCATGG No data
1039906727_1039906743 29 Left 1039906727 8:41791819-41791841 CCACAGAGGCTCCCCGCTGCCTT 0: 1
1: 0
2: 8
3: 33
4: 328
Right 1039906743 8:41791871-41791893 TCAGGAAGGAAAACCCTTCCAGG No data
1039906727_1039906732 -9 Left 1039906727 8:41791819-41791841 CCACAGAGGCTCCCCGCTGCCTT 0: 1
1: 0
2: 8
3: 33
4: 328
Right 1039906732 8:41791833-41791855 CGCTGCCTTCCAGACACCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039906727 Original CRISPR AAGGCAGCGGGGAGCCTCTG TGG (reversed) Intronic
900241801 1:1620809-1620831 CAGGCAGTGGGGAGCTGCTGGGG + Intronic
900372758 1:2339604-2339626 AGGGCAGTGGGGAGCCTTGGGGG - Intronic
900414730 1:2529746-2529768 AAGGCTGCGGGGAGACGCGGCGG + Exonic
900472481 1:2861629-2861651 CTGGCAGAAGGGAGCCTCTGGGG + Intergenic
900577184 1:3389230-3389252 AGGGCAGTGGGGAGCCTCTGGGG - Intronic
900695640 1:4008145-4008167 CAGGCACAGGGGAGCCACTGGGG - Intergenic
901118844 1:6873549-6873571 AAGGCAGATGGGAGCCCCAGGGG - Intronic
901134295 1:6982993-6983015 TCTGGAGCGGGGAGCCTCTGAGG + Intronic
902273324 1:15322208-15322230 TAGGCAGTGGGGAGCTACTGAGG + Intronic
902335541 1:15752257-15752279 AGAGCAGCGGGGAGCCACAGAGG + Intergenic
902404470 1:16175216-16175238 GAGGTAGTGGGGAGCTTCTGGGG - Intergenic
902585960 1:17438728-17438750 AGGGCAGCCGGGAGCCCCAGAGG + Intronic
902768940 1:18634552-18634574 AAGCCAGCTGCCAGCCTCTGTGG - Intronic
902771670 1:18648756-18648778 AGGGCAGCGGGGAGCCATGGAGG + Intronic
902784067 1:18721630-18721652 GAGGCTGCTGGGGGCCTCTGGGG + Intronic
903141316 1:21340870-21340892 AGGGCAGTGGGGAGCCACTCAGG - Intronic
903555653 1:24191247-24191269 AAGGGAACTGGAAGCCTCTGTGG - Intergenic
903658601 1:24963695-24963717 AAGGCAGCAGGGGGTGTCTGAGG + Intronic
903812213 1:26041030-26041052 AAGGCTGCGGTGAGCCTTGGTGG + Intronic
904029178 1:27523331-27523353 GAGGCTGTGGAGAGCCTCTGGGG + Intergenic
904266803 1:29322990-29323012 AAGGCTGGGGGGAGGTTCTGGGG + Intronic
904862149 1:33546450-33546472 AAGGCAGAGGAAAGGCTCTGTGG + Intronic
905293495 1:36939473-36939495 AAGGCAGACGGGAGCCTCCTAGG + Intronic
905304131 1:37005924-37005946 TAGGCAGTGGGGAGCCCTTGAGG + Intronic
905488250 1:38323049-38323071 TGGGCACCGGGGAGCCCCTGAGG + Intergenic
905933447 1:41806102-41806124 AAGGCAGAGGGCAGGCTCTGGGG - Intronic
906052465 1:42886856-42886878 AGGGCAGCCAGGAGCCCCTGGGG + Intergenic
911086815 1:93985571-93985593 AGGGCTGAGGGGAGCCTCAGGGG + Intergenic
911986537 1:104632681-104632703 AAGGCAAAGGGGAGCCTGTGCGG + Intergenic
913126426 1:115794619-115794641 CAGGCAGTGGGGAGCCACAGAGG + Intergenic
914876184 1:151514018-151514040 AAGGCAGCAGGGCAGCTCTGAGG - Intronic
914954922 1:152153229-152153251 AAGTCACTGGGGAGCCACTGAGG + Intergenic
915272151 1:154760875-154760897 AGGGCCGCGGGGCGCCTTTGCGG - Intronic
919835131 1:201568149-201568171 AAGGCAGTGGGGGGCAGCTGTGG + Intergenic
920390562 1:205597867-205597889 AAGGGAGAGGGGAGCATTTGGGG + Intronic
920962079 1:210672307-210672329 GAGGCTGCGGGAAGCCCCTGGGG - Intronic
921034095 1:211359764-211359786 AAGGCAGAGGGTAGGCTCTCAGG - Intronic
921365251 1:214367640-214367662 AAGGCTACAGGGAGCATCTGGGG + Intronic
922741892 1:228018798-228018820 CAGGCAGCGGGGAGCTCCTGTGG - Intronic
923300792 1:232638783-232638805 AGGGCAATGGGAAGCCTCTGAGG - Intergenic
1062791259 10:307909-307931 AGGGCAGCAGGGAGGCTTTGGGG + Intronic
1062791280 10:307967-307989 AGGGCAGCAGGGAGGCTTTGGGG + Intronic
1062791320 10:308083-308105 AGGGCAGCAGGGAGGCTTTGGGG + Intronic
1063698519 10:8361551-8361573 AAGGCATCTGGAAGCCTCTAAGG + Intergenic
1063963810 10:11329060-11329082 ATGAGAGCAGGGAGCCTCTGGGG - Exonic
1065048005 10:21761325-21761347 AAGGCAGGGGGGATCCCCTGAGG + Intronic
1065322168 10:24520000-24520022 AAGGCAGGGGGGAGGAGCTGGGG + Intronic
1065482769 10:26212079-26212101 AGCGCAGCAGGCAGCCTCTGCGG - Exonic
1065733742 10:28732552-28732574 AAGGAGGTGGGAAGCCTCTGGGG + Intergenic
1065955065 10:30686257-30686279 AAGGCAGTGGGATGTCTCTGGGG + Intergenic
1067303522 10:45036447-45036469 CAGGCAGCTTGGAGGCTCTGGGG - Intergenic
1069305609 10:66965137-66965159 AAGACAGCTGGGAGCCACGGTGG + Intronic
1070663811 10:78329197-78329219 GAGGCAGCAGGGAGCCGCAGAGG - Intergenic
1070771504 10:79085104-79085126 CAGGCAGCAGGCAGCCTCTGGGG - Intronic
1071369423 10:84935962-84935984 AAGGCTGCGGTCAGACTCTGTGG + Intergenic
1072521294 10:96232186-96232208 GAGGGAGCTGGGACCCTCTGTGG - Intronic
1073042939 10:100619685-100619707 CAGGCAACGGGGAGCCTTTGAGG - Intergenic
1073302007 10:102476564-102476586 ATGGCAGCGGGTAGCTCCTGGGG + Exonic
1074183615 10:111083314-111083336 CAGGCACAGGGGATCCTCTGGGG - Intergenic
1075870351 10:125768346-125768368 AGGACAGTGGGGAGCCTCTCTGG - Intronic
1076228256 10:128798741-128798763 AACTCAGCAGTGAGCCTCTGTGG + Intergenic
1076270724 10:129150133-129150155 CAGGCACCTGGGAGCTTCTGGGG - Intergenic
1076699738 10:132265225-132265247 AGGGCAGCGAGGTGGCTCTGGGG + Intronic
1076995896 11:297382-297404 GAGGCTGCGGGGAGGCCCTGGGG - Intergenic
1077176257 11:1192326-1192348 AGGTCACCGGGCAGCCTCTGGGG - Intronic
1077369114 11:2173325-2173347 AGGGCAGCGAGGAGCCACGGAGG - Intergenic
1077704226 11:4468547-4468569 AAGGAAGCAGGCATCCTCTGTGG - Intergenic
1078357522 11:10643340-10643362 AAGACACCGGGGAGCCTTTGGGG - Intronic
1079040103 11:17051650-17051672 GAGGGAGCGTGGAGCCTCCGAGG - Intergenic
1080776977 11:35395113-35395135 AGGGCAGTGGGGATCCACTGTGG + Intronic
1081969062 11:47186019-47186041 CAGGGAGCGAGGACCCTCTGGGG + Intronic
1082003839 11:47408994-47409016 AAGCCAGCGGGGCTCCACTGGGG - Intronic
1083631604 11:64098194-64098216 AGGGCAGGGGGGAGGCTGTGAGG - Intronic
1083928082 11:65821268-65821290 CAGGGAACGGGGAGTCTCTGAGG + Intergenic
1083929787 11:65835174-65835196 AAGGGAGTGGGGAGCCTCTGTGG + Intronic
1084028393 11:66466916-66466938 GAGGCAGCGCGGAGCCGCCGCGG + Exonic
1084447109 11:69210036-69210058 AAGGCAGGGAGGCTCCTCTGTGG + Intergenic
1084531934 11:69732515-69732537 AAGGCAGGGCTGAGCCCCTGCGG + Intergenic
1084593803 11:70105431-70105453 AAGGAAGCAGGGATCTTCTGGGG + Intronic
1084750071 11:71198738-71198760 AAGACAGCAGTGAGCCTCTGAGG + Intronic
1084949061 11:72654701-72654723 AGAGCAGCTGGGTGCCTCTGAGG - Intronic
1085389582 11:76175647-76175669 CAGGCAGTGGGGAGCCACAGAGG + Intergenic
1085411267 11:76292097-76292119 GAGGGAGCAGGGAGCCCCTGGGG - Intergenic
1085518477 11:77124711-77124733 CAGGCAGCTGGGGGCCTTTGGGG + Exonic
1089120729 11:116132819-116132841 GCGGCAGGGGGGACCCTCTGAGG - Intergenic
1089158975 11:116423517-116423539 AATGCAGCGGAGTGTCTCTGAGG - Intergenic
1089479999 11:118796914-118796936 AAGGAAACTGGGAGCCACTGAGG - Intergenic
1090387682 11:126366119-126366141 CAGGCAGCCCGGAGCCTCTAAGG - Intronic
1090997009 11:131875927-131875949 GAGGCAGCGAGGAGCCTCCCAGG + Intronic
1091196314 11:133733812-133733834 TACGCAGCGGGGAGCCTCTGAGG + Intergenic
1093652068 12:21657523-21657545 AAGGCAGAGGGTAGCAGCTGCGG - Exonic
1095386316 12:41654702-41654724 TTGGCAGTGGGGAGCCACTGTGG + Intergenic
1096238184 12:49943734-49943756 GAGGCAGCTGGGAGCCATTGTGG - Intergenic
1098202332 12:68069103-68069125 AGGGCAGCAGGGACCCTCTCAGG + Intergenic
1099927507 12:89035603-89035625 AAGGCAGCAGTGAGCATCAGTGG - Intergenic
1100458523 12:94776080-94776102 TAGGCACAGGGGAGCCACTGGGG + Intergenic
1102102786 12:110293625-110293647 AAGGCAGGGGGAATCATCTGAGG - Intronic
1102349090 12:112179095-112179117 GAGGCAGCGGGGAGGCTCTCAGG + Intronic
1102521546 12:113480194-113480216 AAGGCAGGGGTGAGCCACGGTGG + Intergenic
1102937332 12:116908827-116908849 AAGGCAGCAGAGATGCTCTGGGG - Intergenic
1103713504 12:122929828-122929850 AGGGCAGCTGGGGGCCTCCGTGG + Exonic
1104444831 12:128824320-128824342 CAGGCAGCGGCGAGCGCCTGCGG - Intergenic
1104847846 12:131855748-131855770 AAGCCAGCGGGCACACTCTGAGG + Intergenic
1105555760 13:21447213-21447235 GAGGGAGCGTGGAGCCTCCGAGG + Intronic
1105851775 13:24341268-24341290 AACGCAGCGGAAAGCCTCTATGG + Intergenic
1107123339 13:36819153-36819175 CAGGGAGCGCGGCGCCTCTGGGG - Intergenic
1108704759 13:52974942-52974964 AAGGCAGCTGGAAGACTCTGAGG - Intergenic
1110333662 13:74301735-74301757 ACTGCAGCAGGGAGCATCTGTGG + Intergenic
1111113514 13:83746777-83746799 TAGGCATAGGAGAGCCTCTGTGG - Intergenic
1114424661 14:22611837-22611859 AAGGCACAGGGGAGGCTCAGAGG - Exonic
1115549361 14:34491166-34491188 AAGGGTGTGGGGAGGCTCTGTGG - Intergenic
1117279067 14:54219924-54219946 AAGGCGGCCGGGGCCCTCTGCGG + Intergenic
1117900604 14:60528841-60528863 AAGGCAGCAGACAGCTTCTGCGG - Intergenic
1117985065 14:61379017-61379039 AGGGCAATGGGGAGCCACTGAGG - Intronic
1118818142 14:69327032-69327054 GAGGTAGCAGGGAGCCACTGAGG + Intronic
1121086076 14:91147008-91147030 AAGACAGTGAGAAGCCTCTGGGG - Intronic
1121836883 14:97100333-97100355 AAGGCAGCGAGTAGCTGCTGAGG + Intergenic
1122275938 14:100590855-100590877 CAGGCAGCTGGGAGCCTCGTAGG + Intergenic
1122309056 14:100783230-100783252 AAGGCAGGGTGGAGGCCCTGGGG + Intergenic
1122852373 14:104543591-104543613 AAGCCAGCCGGGTGCCTCTCAGG + Intronic
1122863998 14:104595359-104595381 TGGGCAGCAGGGAGTCTCTGGGG + Intronic
1122876165 14:104666356-104666378 AGGGGAGCTGGGAGCCACTGTGG - Intergenic
1123016081 14:105376394-105376416 AAGGCAAAGGGGAGCCTCCTGGG + Intronic
1124101538 15:26698737-26698759 AAGCCAGGCGGGAGCCTTTGGGG - Intronic
1124209690 15:27752813-27752835 GAGGCAGCTGTGGGCCTCTGGGG - Intergenic
1124268427 15:28258236-28258258 AAGGCGGCGGGGATCACCTGAGG + Intronic
1125733098 15:41905230-41905252 AAGGCAGCCTGGAGCCTGTCAGG - Intronic
1125789513 15:42353176-42353198 CAGGCAGCAGGGAGCCACTGAGG - Exonic
1127309212 15:57737716-57737738 AAGGTTGCGGGGAGGTTCTGTGG + Intronic
1128511011 15:68313916-68313938 CAGGCAGCGGGAAGGGTCTGAGG + Intronic
1129087779 15:73114349-73114371 AAGGCAACGGCAAGCCTTTGAGG + Intronic
1129314368 15:74732302-74732324 AAGGCAGGGGGGATCACCTGAGG - Intergenic
1129750538 15:78059753-78059775 GAGGCTGAGGGGAGTCTCTGGGG - Intronic
1129868892 15:78928644-78928666 AAGGCCGCATGGAGCCTCGGCGG + Intronic
1130246917 15:82260534-82260556 TAGGCAGTAGGGAGCCTTTGGGG - Intronic
1131868234 15:96734313-96734335 AAGGGAGAGGGTATCCTCTGAGG + Intergenic
1131958680 15:97765344-97765366 AAGGCAGCAGGGAGCCCCACTGG + Intergenic
1132238491 15:100239628-100239650 ATGGCAGGAGGCAGCCTCTGTGG - Intronic
1132451418 15:101970817-101970839 AAGGCCGCGGTGAGCCCCAGGGG - Intergenic
1132674369 16:1115573-1115595 TGGGCAGCGCCGAGCCTCTGTGG + Intergenic
1132695410 16:1199697-1199719 AAGGCTGAGGGGAGACTCGGGGG - Intronic
1132850459 16:2022780-2022802 TAGGCAGTGGGGAGCCCTTGAGG - Intergenic
1132942325 16:2514340-2514362 AGGGCTGCGGGGAGCCGCCGGGG + Intronic
1135724499 16:24844417-24844439 AAGGCAGTGGGGTGCCACCGAGG - Intergenic
1136055811 16:27688791-27688813 AAGGAAGCCTGGAGCCACTGGGG - Intronic
1136331681 16:29583248-29583270 AAGGCAGGGGGGATCACCTGAGG + Intergenic
1136446319 16:30322988-30323010 AAGGCAGGGGGGATCACCTGAGG + Intergenic
1137595221 16:49719150-49719172 AAGGCAGCAGGGCCTCTCTGGGG + Intronic
1137887535 16:52122624-52122646 CAGGCAGCTGGCAGCCTCAGTGG - Intergenic
1138549293 16:57738800-57738822 TAGGCACTGGGGAGCCACTGGGG + Intronic
1140714039 16:77705964-77705986 CAGGCAGCGGGGAGGCACTGGGG - Intergenic
1142320635 16:89380552-89380574 AAGGCAGCGGGCAGGTCCTGGGG - Intronic
1142640563 17:1283344-1283366 GTGGCAGCGGGGAGCCTCCCGGG + Intronic
1142863230 17:2776202-2776224 CAGGCAGCGGGGAGTTTCAGGGG + Intergenic
1144415766 17:15044623-15044645 AGGGCAGCGGGGAGCCACGAAGG - Intergenic
1144429019 17:15173641-15173663 CAGGCAGTGGGGAAGCTCTGTGG + Intergenic
1144589753 17:16514174-16514196 AAGGAAGGGGGGATTCTCTGAGG - Intergenic
1147127043 17:38378223-38378245 AAGGCAGGGGCGAGCGTCAGTGG + Intronic
1147391773 17:40113665-40113687 AAGCCAGCGTGGAGCCACAGAGG - Intergenic
1148108648 17:45132458-45132480 AGGGCAGCGGGGCGCCGCTCTGG + Exonic
1149519283 17:57306132-57306154 GAAGCAACTGGGAGCCTCTGGGG + Intronic
1150675197 17:67239239-67239261 AAGGCAGCAGGCAGTCTCTTCGG + Intronic
1151323356 17:73364597-73364619 AAAGAAGAGGGGAGCCCCTGAGG - Intronic
1151620656 17:75242970-75242992 TGTGCTGCGGGGAGCCTCTGGGG - Intronic
1151915259 17:77113347-77113369 AAGGCAGAGGTGAGAATCTGAGG - Intronic
1152070801 17:78132727-78132749 AAGGCATAGGTGAGGCTCTGCGG - Intronic
1152251693 17:79215864-79215886 AAGGCAGTGGGAAGCCACTCTGG + Intronic
1152903771 17:82959691-82959713 AAGAAAGCGGGGGGCCTCTGTGG + Intronic
1155618352 18:27746964-27746986 AAGCCAGCAGAGTGCCTCTGTGG + Intergenic
1158316954 18:56221699-56221721 AAGGCAGCAGATGGCCTCTGGGG + Intergenic
1159784917 18:72701933-72701955 AAGGCACCTGGCAGCCGCTGCGG + Intergenic
1160820372 19:1054987-1055009 CTGGGAGCTGGGAGCCTCTGTGG + Intronic
1161026299 19:2038857-2038879 GGGGCAGCGGCGAGCCCCTGGGG + Exonic
1161265990 19:3365043-3365065 CATGCAGAGGGGAGCCTGTGGGG + Intronic
1161321634 19:3644173-3644195 AAGGCAGCGGTGGGCCCCAGCGG + Exonic
1161515804 19:4695585-4695607 AGGGAAGCTGGGAGCCTCAGTGG + Intronic
1161761085 19:6173197-6173219 AAGGGACCAGTGAGCCTCTGGGG - Intronic
1162135008 19:8550117-8550139 AAGGCAGAGTGGATGCTCTGGGG - Intronic
1162970787 19:14180096-14180118 AAGGCTTGGGGGAGCCTCTATGG + Intronic
1163258694 19:16173508-16173530 GAGGAAGCTGGGAGCCTTTGGGG - Exonic
1163611972 19:18306368-18306390 AAGGCTCCGGGTAGCATCTGTGG - Exonic
1163684901 19:18706436-18706458 AAGGCGGGGGGGATCATCTGAGG - Intronic
1164320258 19:24137924-24137946 CAGGCAGCAGGGAGGCCCTGGGG - Intergenic
1164686194 19:30168310-30168332 AGAGCAGTGGGGAGCCACTGGGG - Intergenic
1165826525 19:38708942-38708964 TAAGCAGTGGGGAGCCTGTGAGG + Intronic
1167322420 19:48805431-48805453 AAGGGTGCTGGGAGCCACTGAGG - Intronic
1167510483 19:49893172-49893194 GAGGCAGCGGGGAGCCACTGGGG + Intronic
1168258329 19:55179296-55179318 AAGTCAGCGGGATGCCTGTGGGG - Intronic
925364592 2:3303286-3303308 CAGGCTAAGGGGAGCCTCTGGGG + Intronic
925730943 2:6918875-6918897 AGGGCAGCAGGGATCCACTGGGG - Intronic
926977348 2:18528234-18528256 AAGGCAGCAGAGAGCTGCTGAGG - Intergenic
930688156 2:54330938-54330960 CAGGCAGCGAGGAGCCTCCTGGG - Exonic
931912956 2:66922125-66922147 AAGGCAGGAGGTAGGCTCTGAGG + Intergenic
933918611 2:87022019-87022041 AAGGCAGCATGGAGCAGCTGAGG - Intergenic
934004384 2:87747896-87747918 AAGGCAGCGTGGAGCAGCTGAGG + Intergenic
935206617 2:100901837-100901859 AAGGCGGGTGGGATCCTCTGAGG - Intronic
935284513 2:101552282-101552304 TAGGCAGCGGGGAGCTGGTGGGG - Intergenic
935767344 2:106381915-106381937 AAGGCAGCGTGGAGCAGCTGAGG + Intergenic
937040873 2:118819725-118819747 AGGGTGGCAGGGAGCCTCTGAGG - Intergenic
937145316 2:119639231-119639253 CAGGCAGCGGGGACCCACGGAGG - Intronic
937198828 2:120183599-120183621 AAGGCAATGGGAAGCCACTGAGG - Intergenic
937306390 2:120874085-120874107 TGTGCAGCCGGGAGCCTCTGGGG - Intronic
937476919 2:122223765-122223787 AAGTCACCGGGGAGCCCCAGGGG - Intergenic
942137580 2:172943156-172943178 AAGGAAGAAGGGAGCCACTGAGG + Intronic
942629938 2:177944738-177944760 GAGGGAGCGTGGAGCCTCCGAGG + Intronic
945032992 2:205682474-205682496 AAGGCAGTGGGGAGCCGGAGGGG + Intronic
945259548 2:207831143-207831165 AAGGCAGCAGGCAGCCTGGGGGG - Intronic
946182912 2:217959794-217959816 GAGGCAGCTGGACGCCTCTGTGG + Intronic
947860336 2:233353780-233353802 AAGGCAGCAGGAAGCCCTTGAGG - Intergenic
948656081 2:239477268-239477290 AAGGCAACAGGGAGCCACTGAGG + Intergenic
1169421761 20:5466195-5466217 AAGGCACAGGGGAGCCATTGAGG + Intergenic
1169907980 20:10622831-10622853 AAGGCAGCTGAGAGCCACTGGGG + Exonic
1172308052 20:33895820-33895842 AAAGCACTGGGGAGCCACTGAGG - Intergenic
1172620561 20:36315921-36315943 AAGGCAGTGGGCAGCCTGGGAGG + Intronic
1172630392 20:36374527-36374549 AAGGCAGTGGGGAGCCTTTGGGG + Intronic
1174173250 20:48629802-48629824 AGGGCAGTGGGGAGCCACAGAGG - Intronic
1174764458 20:53239294-53239316 CAGGAAGCTGGGACCCTCTGGGG + Intronic
1178594527 21:33941085-33941107 AAGGCAGTGGGGAGCCACTGTGG - Intergenic
1178843694 21:36157172-36157194 AGGGCAGCGGGGAGACTGGGTGG + Intronic
1179133531 21:38660430-38660452 AAGGCAGCGGGGTGGCCCTAGGG - Intronic
1179145933 21:38767356-38767378 AAGACAGCGTGGTCCCTCTGAGG + Intergenic
1179281964 21:39941394-39941416 AAGGCATCAGGGAGCCTCCTGGG - Intergenic
1179532026 21:42026205-42026227 ACGGGAGTGGGGAGCCACTGGGG - Intergenic
1179838728 21:44056095-44056117 ACTGCCCCGGGGAGCCTCTGGGG + Intronic
1180090446 21:45531246-45531268 GAGGTGGCGGAGAGCCTCTGGGG + Intronic
1180609457 22:17085808-17085830 ACGACAGCGGGGTCCCTCTGGGG - Intronic
1182677177 22:32048439-32048461 TAGGCAGTAGGGAGCCACTGAGG - Intronic
1183730407 22:39615310-39615332 AAGGCAATGGGGAGTCACTGAGG + Intronic
1183898974 22:40991011-40991033 TAGGCAGCGTGGAGCCTCATGGG - Intergenic
1184411548 22:44329075-44329097 GAGGCAGTGGGGAGCTCCTGGGG - Intergenic
1185149853 22:49158090-49158112 ACGGCAGCTGGGAGCTTCTCAGG - Intergenic
1185322769 22:50209491-50209513 AAGGCCGGGAGGAGCCGCTGGGG + Intronic
949297588 3:2543933-2543955 AAGGAAGCGACAAGCCTCTGTGG + Intronic
949376196 3:3392896-3392918 AAAGCTGCTGGGATCCTCTGTGG - Intergenic
949461034 3:4294497-4294519 GAGGCTGCAGTGAGCCTCTGAGG + Intronic
949534256 3:4983585-4983607 AAGGGAGAAGGGAGTCTCTGGGG - Exonic
950851255 3:16064134-16064156 AAGGCAGGGGGGATCACCTGAGG + Intergenic
952889026 3:38029086-38029108 CAGGCTTTGGGGAGCCTCTGGGG + Intronic
952947658 3:38490254-38490276 AAGCCAGCGGGCAGGGTCTGGGG - Exonic
953926784 3:46986656-46986678 AAGGCAGCTAGGGGTCTCTGTGG + Intronic
954710502 3:52503047-52503069 CCTGCAGCTGGGAGCCTCTGCGG - Exonic
960987106 3:123287831-123287853 CAGGCAGCTGGGAGCCTGTGTGG - Intronic
961168535 3:124780019-124780041 AGGGCAGAAGGGGGCCTCTGTGG - Intronic
961504888 3:127363369-127363391 AAGGCAGCAGGGGCCGTCTGTGG - Intergenic
961643256 3:128378523-128378545 CAGGCAGCAGGGAGCCACTGAGG + Intronic
962258112 3:133886004-133886026 CAGGCAGTGGGGATCCACTGGGG - Intronic
962848546 3:139290677-139290699 AAGGCAGCCGGGAGCCACCGGGG - Intronic
965003646 3:162988062-162988084 AAGCCAGCGGGTTGCCGCTGCGG - Intergenic
966351420 3:179036085-179036107 GAGGCAGCAGGGAGCCTCTGAGG + Intronic
967304000 3:188043136-188043158 AAGGCACTGGGGAGCCACAGAGG - Intergenic
969251989 4:5974040-5974062 AGGGCAGTGCGGAGCCCCTGGGG - Intronic
969315913 4:6381215-6381237 GAGGCAGCAGGGAGCCTGAGGGG + Intronic
969433237 4:7168285-7168307 CAGGCAGTGGGGAGCCACAGCGG - Intergenic
970595022 4:17592208-17592230 AAGGCAGAAGGGAACTTCTGGGG - Intronic
971126268 4:23758763-23758785 AACGCAGCGGGGAGCTTTAGGGG - Intronic
971231030 4:24800275-24800297 AAGGCAGAGGGGGGCCTCGGGGG - Exonic
971368220 4:25994416-25994438 AAGGCAGGGGGGATCACCTGAGG + Intergenic
971516597 4:27494692-27494714 CAGGCAGAAGGGAGCCTATGTGG + Intergenic
972615139 4:40690944-40690966 AGGGCAGCTGGGAGCCACTGGGG - Intergenic
972766559 4:42156740-42156762 AAGGCAGCGGGAAGTCTTGGAGG + Intergenic
973074328 4:45903949-45903971 TAGGCAGTGGGGATTCTCTGTGG + Intergenic
976108460 4:81644564-81644586 AAGGCAATTGGGAGACTCTGTGG - Intronic
982289247 4:153763517-153763539 AAGGCTGGAGGGAGCCACTGCGG - Intergenic
982713470 4:158782167-158782189 AAGGCAATGTGGAGCCACTGAGG + Intronic
983332499 4:166348449-166348471 AAGGCAGGGGGGATCCCCCGAGG + Intergenic
985495426 5:201939-201961 AAGGCAGAGAGGACCCTTTGGGG - Exonic
988577923 5:32444549-32444571 CGGGCAGCGGGGAGCCGCGGGGG - Intronic
988640138 5:33032762-33032784 AACGCAGCTGAGAGCCACTGTGG - Intergenic
988813568 5:34808578-34808600 AAGGCAGCCCTGAGCCGCTGGGG - Exonic
989159129 5:38373405-38373427 AAGGCAGCGGGGAGGTTGGGAGG - Intronic
989218278 5:38927273-38927295 TAGGCAGTGGGGATTCTCTGTGG + Intronic
990007840 5:50963978-50964000 AAGGCAGAGTGGAGTCCCTGGGG - Intergenic
990360409 5:55013269-55013291 AAGGCAGCAGCGAGGCTCGGGGG + Intronic
990412111 5:55551701-55551723 AAGGCAGAGGAGGGCCTCTTCGG + Intergenic
991345902 5:65668182-65668204 AAGGCAGGGGGGATCACCTGAGG - Exonic
991911827 5:71570372-71570394 GGGGCAGATGGGAGCCTCTGAGG - Intergenic
993755217 5:91720755-91720777 AAGGCAGCAGGAAGTCTTTGAGG + Intergenic
999326514 5:150647587-150647609 AAGGCAGTGGGGAGGAACTGGGG + Intronic
999690462 5:154141755-154141777 CAAGCAGAGGTGAGCCTCTGAGG + Intronic
1001140634 5:169140859-169140881 AAGGCAGTGAGGAACCACTGAGG - Intronic
1001301276 5:170535542-170535564 CAAGCAGGAGGGAGCCTCTGAGG - Intronic
1001328987 5:170749062-170749084 GAGGCAGCTGGCTGCCTCTGAGG - Intergenic
1001671044 5:173474237-173474259 AAGGCAGTGGAGAGCCACAGGGG + Intergenic
1002813476 6:656957-656979 AAGGCAGCTGGGGGCCTCTGAGG + Exonic
1002903227 6:1427212-1427234 AAGTAAGCGGGGAGCCTGTAAGG + Intergenic
1003701402 6:8468948-8468970 AAGGCTGCTGGAGGCCTCTGAGG - Intergenic
1004021187 6:11776842-11776864 GAGGCAGGAGGGAGCCACTGTGG + Intronic
1005455733 6:26017912-26017934 AAGGCAGCTGGGGGCCTCTAGGG + Intergenic
1006083701 6:31581755-31581777 CAGGGAGCTGGGAGCCCCTGAGG + Intronic
1007336195 6:41156925-41156947 CAGGCCGCGGGGAGCCTCCCAGG + Intergenic
1007340129 6:41186072-41186094 GAGGCAGCGGGGAAACCCTGGGG + Intergenic
1007683617 6:43651308-43651330 AAGGCAGTGGGTAGGCTCTGGGG + Intronic
1010395146 6:75383145-75383167 AAGGCAGTGGAGGGGCTCTGTGG + Intronic
1011622255 6:89253894-89253916 AAGGCAGCAGGGAAGCTCTAGGG - Intergenic
1011909310 6:92415790-92415812 AAGGCAACAGGGAGCCACAGGGG + Intergenic
1014291360 6:119562243-119562265 AAGGCAGCTGGGAGTGTCTGAGG + Intergenic
1015229727 6:130900804-130900826 AAGGCAACGTGGAGCCCTTGAGG - Intronic
1016509402 6:144824225-144824247 AGAGCAGTGGGGAGCCTTTGGGG + Intronic
1016649264 6:146445396-146445418 CTGGCAGCGGAGAGCCTCAGAGG + Intergenic
1018474654 6:164128788-164128810 AAAGCAGCAGGGAGCAACTGTGG + Intergenic
1018635045 6:165853962-165853984 ACGGTGGCGGGGAGGCTCTGGGG + Intronic
1018769230 6:166957040-166957062 GAGGCTGCGGGGAGCCTGGGCGG - Intronic
1018838017 6:167499634-167499656 ATGGCAGCTGGAGGCCTCTGTGG - Intergenic
1019347892 7:539526-539548 GAGGCACCAGGGAGCGTCTGCGG + Intergenic
1019370275 7:659529-659551 AAGGGAGCTGGGAGCCAATGGGG + Intronic
1019483187 7:1275495-1275517 CCGGCTGCGGGGACCCTCTGCGG + Intergenic
1019621645 7:1995406-1995428 GAGGAAGCGGGGAGCCTCCCTGG - Intronic
1019638259 7:2088457-2088479 AGGCAAGCGGGGAGCCTCTCTGG - Intronic
1022957021 7:35390366-35390388 AAGGCTGGCGGGAGTCTCTGTGG - Intergenic
1023177419 7:37448057-37448079 TGGGCAGCCGGGAGCCCCTGAGG - Intronic
1023827367 7:44018666-44018688 CAGGCAGCGAGGAGCCACTGCGG + Intergenic
1023959605 7:44915406-44915428 CAGGCAGCGCTGAGCCTGTGGGG - Intergenic
1024559046 7:50628309-50628331 GAGAGAGCGGGGAGCCTCGGAGG - Intronic
1026400819 7:70011149-70011171 AAGCCTGAGGGGAGCCACTGAGG + Intronic
1026449504 7:70515166-70515188 CAGGCAGTGGGGAGCCGTTGAGG + Intronic
1027258415 7:76446019-76446041 AAGGCAGTGGCAAGCCACTGAGG + Intergenic
1027280433 7:76605999-76606021 AAGGCAGTGGCAAGCCACTGAGG - Intergenic
1027370906 7:77508483-77508505 GAGGGAGCGTGGAGCCTCCGAGG + Intergenic
1029160803 7:98550494-98550516 AAGGCTATGGGGAGCGTCTGAGG - Intergenic
1029599609 7:101556014-101556036 AGGGCAGCAGGGAGCCACTGAGG - Intronic
1029738523 7:102478413-102478435 CAGGCAGCGAGGAGCCACTGCGG + Intronic
1029755653 7:102572076-102572098 CAGGCAGCGAGGAGCCACTGCGG + Intronic
1029773602 7:102671156-102671178 CAGGCAGCGAGGAGCCACTGCGG + Intronic
1030070825 7:105696003-105696025 AATGCAGAGGGGAGCCTGTCAGG + Intronic
1034259001 7:149742468-149742490 AAGGCAGCGTGGGATCTCTGAGG - Intergenic
1035543293 8:458975-458997 AAGGCAGGGGGGAGGGGCTGTGG - Intronic
1035719418 8:1780530-1780552 AAGGCAACGGGCAGCTGCTGCGG + Exonic
1037608691 8:20458596-20458618 AAGGCAGGTGGGAGCTTTTGAGG + Intergenic
1037876793 8:22552421-22552443 AAGGAAGAGGGCAGCATCTGGGG - Intronic
1038357461 8:26842684-26842706 GAGGAAGTGGGGAGCCACTGGGG - Intronic
1038616053 8:29096213-29096235 AAGGCAGGGGGGATCACCTGAGG - Intronic
1039893074 8:41697475-41697497 AAGGTGGCTGGGAGCATCTGTGG - Intronic
1039906727 8:41791819-41791841 AAGGCAGCGGGGAGCCTCTGTGG - Intronic
1040523553 8:48198472-48198494 AAGGCAGAGAGGAGACTGTGTGG + Intergenic
1041296610 8:56363193-56363215 AGGGCAGTGGGGACCCTCTCAGG + Intergenic
1041390528 8:57343622-57343644 AATGGAGCTAGGAGCCTCTGAGG - Intergenic
1043508967 8:80931298-80931320 AGGGCAGCGGGGAGCCCCGTGGG - Intergenic
1045827391 8:106414848-106414870 AAGGCACCAGGGAGCTACTGAGG + Intronic
1046559979 8:115824005-115824027 AAGGGAGTGGGGAGCTTCAGGGG + Intergenic
1047242044 8:123099575-123099597 CAGACAGTGGGGAGCCTCAGTGG + Intronic
1048712579 8:137228329-137228351 CAGGCAGTGGAGAGCCTCGGGGG + Intergenic
1052842571 9:33305513-33305535 AAGGCTGTGGGAAGCCACTGAGG + Intronic
1053270452 9:36745987-36746009 GAGGCCGCGGGGAGGTTCTGAGG + Intergenic
1056862858 9:90203175-90203197 AAGGCAGCGGGAAGCATGGGAGG + Intergenic
1057587675 9:96344220-96344242 ATGGCAGTGGGAAGCCTCTAGGG + Intronic
1057943345 9:99304004-99304026 AAGGGAGCAGGGAGCCTCACTGG + Intergenic
1059767197 9:117394845-117394867 AAAGCAGTGGGGAGCCACTGAGG + Intronic
1060799626 9:126535321-126535343 AGGGCAGTGGGGAGCCACAGCGG - Intergenic
1061225439 9:129278543-129278565 AAGGCAGGGCGGAGCCTCCCAGG - Intergenic
1061949370 9:133927647-133927669 AACGCAGAGGGGAGGATCTGGGG - Intronic
1062082574 9:134632083-134632105 CAGGCAGGGAGGAGCCTCTGAGG + Intergenic
1187446161 X:19363240-19363262 AAGGGATGAGGGAGCCTCTGGGG - Intronic
1189270799 X:39750488-39750510 AAGGAAGCAGTGAGCCACTGCGG + Intergenic
1190415619 X:50177797-50177819 TAGGCAATGGGGAGCCACTGAGG + Intergenic
1192142177 X:68655078-68655100 ATGGCATCGAGGAGTCTCTGAGG - Intronic
1192218090 X:69177817-69177839 AAGGGAGCGGGGAGACCCTATGG - Intergenic
1192496876 X:71622127-71622149 AAGGCAGAGGGTGGCCTCTCTGG - Intergenic
1192567115 X:72174249-72174271 AAGGAAGAGGGGAGCTGCTGGGG - Intergenic
1192629000 X:72760547-72760569 AAGGCAGCAGACAGCTTCTGCGG - Intergenic
1192652710 X:72960267-72960289 AAGGCAGCAGACAGCTTCTGCGG + Intergenic
1193273750 X:79560360-79560382 AAGGCATAAGGGAGCCTTTGAGG - Intergenic
1195808402 X:108801384-108801406 AAGGCAGCAGACAACCTCTGCGG + Intergenic
1196797576 X:119514628-119514650 AAGGCAACAGGGGGCCACTGGGG + Intergenic
1197299720 X:124763241-124763263 AAGGGAGCAGGGTGCCTCAGTGG + Intronic
1199649659 X:149939349-149939371 AGGGCCGAGGGGAACCTCTGGGG + Intergenic
1199717615 X:150517516-150517538 AAGGGAGGAGGGAGCCCCTGAGG - Intergenic
1200052722 X:153443544-153443566 ATGGCAGCGGGGAGCCGCGGAGG - Intergenic
1200123542 X:153802608-153802630 GTGGGAACGGGGAGCCTCTGGGG - Exonic
1200390317 X:155938572-155938594 AAGGGAGAAGGGAGCTTCTGGGG - Intronic
1201923021 Y:19254857-19254879 AAGGCAGCGGTGAGGCTGGGGGG + Intergenic