ID: 1039906728

View in Genome Browser
Species Human (GRCh38)
Location 8:41791830-41791852
Sequence ATGGTGTCTGGAAGGCAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 177}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039906728_1039906744 30 Left 1039906728 8:41791830-41791852 CCCCGCTGCCTTCCAGACACCAT 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1039906744 8:41791883-41791905 ACCCTTCCAGGCGTTCCTATAGG No data
1039906728_1039906743 18 Left 1039906728 8:41791830-41791852 CCCCGCTGCCTTCCAGACACCAT 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1039906743 8:41791871-41791893 TCAGGAAGGAAAACCCTTCCAGG No data
1039906728_1039906740 4 Left 1039906728 8:41791830-41791852 CCCCGCTGCCTTCCAGACACCAT 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG No data
1039906728_1039906739 0 Left 1039906728 8:41791830-41791852 CCCCGCTGCCTTCCAGACACCAT 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1039906739 8:41791853-41791875 GGGGGGCCCAGAGCTTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039906728 Original CRISPR ATGGTGTCTGGAAGGCAGCG GGG (reversed) Intronic
901172169 1:7266990-7267012 CAGGGGTCTGGAAGGCAGTGGGG + Intronic
901637555 1:10677342-10677364 AGGGTGTCTGGGTGGCACCGAGG + Intronic
901853070 1:12028416-12028438 AAAGTGGCAGGAAGGCAGCGAGG - Intronic
903017792 1:20372858-20372880 ATGATGGCTGGGAGGCGGCGGGG + Intergenic
903212716 1:21827869-21827891 CTGGCATCTTGAAGGCAGCGGGG - Exonic
905998781 1:42405217-42405239 ATTTTGTCTGGAAGACAGGGAGG - Intronic
906308631 1:44737791-44737813 CTGATGACTGGAAGGCAGTGGGG - Intergenic
912217235 1:107628392-107628414 ATTGTGTCTGGATGGCTGAGAGG + Intronic
913233219 1:116759305-116759327 TTGGTGTCTGGAAGTCAGAGTGG + Intronic
916721239 1:167486013-167486035 GTGGTGTGTGGATGGCAGTGGGG - Intronic
919639202 1:200033053-200033075 GTGGTGTATGGAAAGCAGAGTGG + Intronic
919860649 1:201737608-201737630 ATGGTCTCTGGGGGGCTGCGAGG + Intronic
923620558 1:235575821-235575843 ATGGCACGTGGAAGGCAGCGTGG + Intronic
1063451172 10:6151266-6151288 AAGGTGTCTGAAGAGCAGCGGGG + Intronic
1063609140 10:7548236-7548258 ACCGTGTCTGCAAGGCAGAGTGG + Intergenic
1068003713 10:51368045-51368067 ATGGTTTCTGGAAAGCAGGTAGG - Intronic
1071022706 10:81077584-81077606 ATGGTGTAAGGAAGGCATCCAGG + Intergenic
1071822338 10:89291248-89291270 AAGGAATCTGGAAGGCAGGGAGG - Intronic
1071982962 10:91022373-91022395 AAGGTCACTGGAAGGCAGTGAGG - Intergenic
1072899004 10:99391090-99391112 AGGGTGTCTGGCAGTCAGAGGGG + Intronic
1073057810 10:100713486-100713508 CTGGAGTCTAGAAGGGAGCGGGG + Intergenic
1073589412 10:104742349-104742371 GTGCTGTGTGGAAGCCAGCGGGG + Intronic
1073871072 10:107864893-107864915 AGGGTGTGTGGAAGGAAGGGTGG - Intergenic
1074086373 10:110210992-110211014 CTGGTTTCTGGAAGGAAGCAGGG + Intronic
1074864869 10:117539079-117539101 ATGCTGTCTGGGAGGCAGTGGGG - Intergenic
1075105629 10:119538414-119538436 ATGGAGGGTGGGAGGCAGCGAGG + Intronic
1076855990 10:133115875-133115897 AGGGTCTCTGGAAGGCAGGGAGG - Intronic
1077523121 11:3048021-3048043 ATGGTGTCAGGCAGGCAGGCGGG + Intronic
1078603303 11:12752407-12752429 GTACTGACTGGAAGGCAGCGTGG - Intronic
1079163064 11:18012622-18012644 ATAGCGCCTGGAAGACAGCGCGG - Intronic
1081822406 11:46012283-46012305 ATGGTGACAGGAAAGCAGAGAGG - Intronic
1081991447 11:47339742-47339764 ATGGTGTCTGGTATGCGGCCTGG + Exonic
1082725873 11:56736182-56736204 CTGTTGTCTGGAAGGGAGCGGGG - Intergenic
1084541268 11:69788536-69788558 GTGGTGTCTTAAAGTCAGCGTGG + Intergenic
1084873980 11:72117180-72117202 ATGGTGTGTGGAGGGCAGGCTGG + Intronic
1084979661 11:72822362-72822384 CCGGTGTCTGGAAGGGAGGGGGG + Intronic
1085510210 11:77084324-77084346 ATGCTGTGAGGAAGGCAGCATGG + Intronic
1089030087 11:115317221-115317243 ATGCTGTCTGCAAGGCTGCAGGG - Intronic
1090422281 11:126583735-126583757 ACGGTGCCTGGCACGCAGCGAGG + Intronic
1091626849 12:2127593-2127615 GTGGGGTGTGGAAGGCAGGGTGG + Intronic
1093231707 12:16552891-16552913 AAAGTGTCTGAAAGGCAGAGAGG + Intronic
1098707450 12:73708453-73708475 ATTGTGTGTGGAAGACAGTGTGG + Intergenic
1098971748 12:76864339-76864361 AGGGTGTCGGGAAGGAAGTGAGG + Intronic
1101820734 12:108182315-108182337 CTGGTCACTGGAAGGCAGCGAGG + Intronic
1101898056 12:108770399-108770421 ATGGAGGCTGGAAGGAAGGGAGG - Intergenic
1103985090 12:124761602-124761624 ATGGTCTCTGGAAGGGAAGGGGG + Intergenic
1104323050 12:127770272-127770294 GTGGCATCTGGAAGGCAGCCAGG + Intergenic
1104913025 12:132249043-132249065 TGGGTGTCTGGAAGGTGGCGGGG + Intronic
1107199766 13:37700302-37700324 ATGGTGGATGGAAAGCAGTGAGG + Intronic
1109288901 13:60448628-60448650 ATTGTGACTGGAAGGAAGTGTGG + Intronic
1111260267 13:85728926-85728948 ATCATATCTGGAAGGCAGCAGGG + Intergenic
1111854616 13:93622008-93622030 AGGGTGTCTGGGTGGCAGCTGGG - Intronic
1112323575 13:98428672-98428694 ACGGTGGCCGGAAGGCAGGGTGG - Intronic
1114739443 14:25080293-25080315 GTGGAGGCTGGAAGGCAGTGAGG - Intergenic
1120931201 14:89850298-89850320 ATGGTGTCTGTAAGGCAGGTAGG - Intronic
1121184210 14:91952482-91952504 ATGATCTCTGGAAGACAGCAAGG - Intergenic
1123455495 15:20419632-20419654 ATGCTGGATGGAAGGCAGTGAGG - Intergenic
1124010740 15:25836588-25836610 AGGGTGTCTTCCAGGCAGCGCGG + Intronic
1124530433 15:30500749-30500771 TTTGTGTCTGGAGGGCAGGGGGG - Intergenic
1124768226 15:32506939-32506961 TTTGTGTCTGGAGGGCAGGGGGG + Intergenic
1124886617 15:33693367-33693389 ATGGGGTCTGCATGGCAGCCTGG + Intronic
1125420609 15:39500611-39500633 ATGGTGGCTGGCTGGCAGAGGGG + Intergenic
1128000308 15:64185237-64185259 ATGGTGTCTGCAAGTCACCCAGG + Intronic
1130006855 15:80107861-80107883 ATGGGGTTGGGAGGGCAGCGGGG + Intronic
1130115617 15:81002145-81002167 ATGGTGCGGGGAAGGCACCGCGG + Exonic
1130460955 15:84157957-84157979 TTGGTGACTGGAAGGCTGTGTGG - Intergenic
1131377457 15:91937374-91937396 AGGGTCTCTGGGAGGCAGCCAGG + Intronic
1133933776 16:10252650-10252672 ATGGAGTGGGGAAGGCACCGAGG - Intergenic
1134220173 16:12347497-12347519 ATGCAGTCTGGAAGGGAGGGAGG - Intronic
1138332574 16:56226882-56226904 ATGCTTTCTGGAGGGCAGTGTGG - Intronic
1140314686 16:73884193-73884215 ATGGTTTCTGGAAGACAAAGGGG + Intergenic
1140470154 16:75209303-75209325 ATGGGGACTGGAGGGCAGTGTGG - Intergenic
1142782646 17:2193132-2193154 GAGGTGTCTGGATGGCAGGGTGG + Intronic
1143479275 17:7219303-7219325 ATGGTCTCTGGAAGGAACAGAGG + Exonic
1143515715 17:7418306-7418328 ATGGAGCCTGGGAAGCAGCGAGG + Exonic
1144794574 17:17882451-17882473 GTGGTGCCTGGGAGGCACCGGGG - Intronic
1145007554 17:19346140-19346162 AGGCTGTCAGGGAGGCAGCGAGG - Intronic
1146206233 17:30907517-30907539 TTTGTGTCTGGAAGGCAGTGGGG + Intronic
1148289768 17:46434636-46434658 ATGGTGTCCTGAAGGAAGAGTGG - Intergenic
1148311936 17:46652208-46652230 ATGGTGTCCTGAAGGAAGAGTGG - Intronic
1151703637 17:75755858-75755880 ATGGTGGCTGCCAGGCTGCGGGG + Intronic
1151920387 17:77150381-77150403 AGGGTATCTGGAAGGGAGAGGGG - Intronic
1155109900 18:22704048-22704070 AAGGTGTGTGGGAGGCTGCGGGG - Intergenic
1155310987 18:24523149-24523171 TTGGTGGCTGGAAGGTAGAGTGG - Intergenic
1155339705 18:24801582-24801604 ATGGTGGATGGAAAGCAGTGAGG - Intergenic
1156021915 18:32609153-32609175 ACCGTGGCTGGAAGGCAGCGTGG + Intergenic
1157485622 18:48084832-48084854 ATGGTATCTGGGAGCCAGAGAGG + Intronic
1158170373 18:54592197-54592219 CTGGTGTCTGGAAGTCTGCTTGG + Intronic
1159696803 18:71569025-71569047 ATGGTGAATGGAAGGCAGGTAGG + Intergenic
1160926066 19:1546448-1546470 ATGGAGTCGGGGAGGCAGTGGGG + Intergenic
1160981661 19:1819125-1819147 CTGGTTTCTGGAAGGAAGGGAGG + Exonic
1161388348 19:4008455-4008477 ACGGTGTCGGGAAGGGGGCGGGG - Intronic
1163528560 19:17836045-17836067 ATGGTGCCTGGTTGGCAGCAGGG + Exonic
1164469805 19:28520461-28520483 AGGGTGTCTGGTAGGCAGAGCGG - Intergenic
1167512532 19:49903350-49903372 ATGGTGTCTGGAGGGGAGACGGG + Intronic
1167682464 19:50932450-50932472 CTGGTGTGTGGAATGCAGGGGGG + Intergenic
1168208164 19:54867812-54867834 TTGGTGTCTGGTAGGGAGGGGGG + Intergenic
929878061 2:45813506-45813528 ATGGTGTCTGCCAGGGAGCTGGG - Intronic
932493097 2:72133800-72133822 ATGGGGTCTGGGAGGGAGCCTGG + Intronic
932734835 2:74247301-74247323 ATTGCCTCTGGAAGGCAGAGGGG + Exonic
933690852 2:85178517-85178539 CAGCTGTGTGGAAGGCAGCGGGG + Intronic
938634885 2:133212777-133212799 GTGGGGTCTGGAAGGCACAGTGG - Intronic
942068495 2:172294154-172294176 TTGGTGTCTGGAAGCCTGCCAGG - Intergenic
942192924 2:173488705-173488727 ATAGTGTGTAAAAGGCAGCGTGG - Intergenic
943834826 2:192506293-192506315 TTGTTTTCTGGCAGGCAGCGTGG - Intergenic
946369802 2:219274044-219274066 GTGGTGTCTGGAGGGCTGCCTGG - Intronic
946465116 2:219904980-219905002 ATGGTGCCTGGGAGGCAGGGTGG + Intergenic
946550569 2:220797363-220797385 AATGTGACTGGATGGCAGCGGGG - Intergenic
948076471 2:235168694-235168716 ATGGGGCCAGGAAGGCAGCAGGG + Intergenic
1172479725 20:35263950-35263972 ATGGTGTGTGGCAGGGAGAGGGG + Exonic
1173227785 20:41172053-41172075 GTGGTGTCTGGAAGGTACAGGGG + Intronic
1174757439 20:53173840-53173862 AAGGTGTGTGGAAGGCACCCAGG + Intronic
1175514294 20:59559212-59559234 ATGGGGTCTGGAAGGGCGTGGGG + Intergenic
1179908006 21:44434161-44434183 ATGGGGTCTGGAGGTCAGAGTGG + Intronic
1181953666 22:26572666-26572688 ATGGTGAGTGGTAGGCAGAGGGG - Intronic
1182422857 22:30257012-30257034 ATGGTGGCTGGAAGGAGGCCTGG - Intergenic
1183098726 22:35570408-35570430 CTGGAGTCTGGAAGACAACGGGG + Intergenic
1183714834 22:39527551-39527573 CAGCTGTCTGGAAGGCAGCAGGG - Intergenic
1183776778 22:39971313-39971335 GGGGTGTGTGGAAGGCAGTGGGG + Exonic
1184978125 22:48077559-48077581 GTGGTGTCTTGGAGGCAGCTGGG + Intergenic
1185369870 22:50456051-50456073 CTGGTGCCTAGAAGGCAGCTGGG - Intronic
949970383 3:9398128-9398150 ACGGTGTGTGCAAGGCGGCGAGG - Intronic
950713295 3:14829214-14829236 ATGGAGTTGGGAAGGCAGGGTGG + Intronic
952154337 3:30626687-30626709 ATGGTGTCTGAAAGGATGCCTGG - Intronic
954705656 3:52479262-52479284 GTGGTGGCTGGCAGGCAGTGGGG - Intronic
955400594 3:58588427-58588449 ATGGTGTCTGGGGAGCAGAGAGG - Intronic
958718800 3:97820940-97820962 AGGGCTTCTGGGAGGCAGCGTGG + Intergenic
962247771 3:133811276-133811298 GTGGTGTTTGGGAGGCAGCATGG + Intronic
962722412 3:138187834-138187856 ATGGCGTCTGGCAGGCGGGGTGG + Intronic
965685207 3:171295350-171295372 ATGGGATCTGGAAGGCAGGCAGG - Intronic
968006498 3:195246759-195246781 ACGGTGTCTGGAAGGCCATGTGG - Intronic
970835362 4:20398596-20398618 ATGTTGTCTGGCAGCTAGCGAGG - Intronic
970842502 4:20490961-20490983 ATGGTTTCTGGAAGACAGTGGGG - Intronic
973639473 4:52888463-52888485 ATGGTGTCTGGTATGCAGATTGG - Intronic
975091035 4:70404488-70404510 ATGATGTTTTGAAGGCAGAGTGG - Intronic
976010908 4:80487530-80487552 TTGGAGTCTAGAAGGCAGAGAGG + Intronic
978979265 4:114922044-114922066 CTGGTGACTGGAAGGCGGTGGGG - Intronic
987215901 5:15736927-15736949 ATGGTTTCTGGAATACAGTGAGG - Intronic
992174741 5:74138977-74138999 ATGATGTTTGGAAGGCTGCTTGG - Intergenic
993140264 5:84024552-84024574 ATGGTATAAGGCAGGCAGCGTGG + Intronic
997859789 5:137405969-137405991 ACTGTGGCTGGAAGGCAGCCTGG + Intronic
998003005 5:138639500-138639522 GTGGAGCCTGGAAGGCAGAGGGG - Intronic
1001235223 5:170023639-170023661 GGGGTGTCTGGAAGTCAGCGCGG - Intronic
1001588509 5:172849793-172849815 CTTGTTTCTGGAAGGCAGGGAGG + Intronic
1007138139 6:39542898-39542920 ATGGTGTATGGGAGTCAGAGTGG - Intronic
1013219352 6:108063678-108063700 GTGGTGTGTGGCAGGCGGCGGGG - Intronic
1013322677 6:109009773-109009795 ATGGGCTCTGGAGGGCCGCGAGG + Intronic
1017257815 6:152353610-152353632 CTGGTATCTGGAAGTCAGCTGGG + Exonic
1018681778 6:166270982-166271004 TTGGTGGCTGAAAGGCAGCCTGG - Intergenic
1019089636 6:169517776-169517798 ATGGTGTCTAAAAGGCAATGAGG - Intronic
1019177506 6:170167720-170167742 GTGGTGTCCGGAAGGCTGCAGGG - Intergenic
1019923034 7:4174830-4174852 AAGCTGTCTTGAAGGCAGCTGGG - Intronic
1021843325 7:24740943-24740965 ATGGTCTCTGGAAAACAGCCGGG + Intronic
1023390658 7:39708509-39708531 TTGATGTCTGGAGGGAAGCGTGG + Intergenic
1023516835 7:41009626-41009648 ATGGTGGATGGAAGGAAGGGTGG - Intergenic
1025938261 7:66054376-66054398 ATGGTGGCTTGGAGGCAGCTGGG - Intergenic
1026805716 7:73428927-73428949 ATGGTGGCTGCAAGGCACAGAGG + Intergenic
1029637360 7:101793937-101793959 ATGGTGTCTGGGGAGCAGGGAGG + Intergenic
1030113795 7:106048325-106048347 AAGGTGTTTGGAATGCAGAGGGG + Intergenic
1031984593 7:128155319-128155341 CTTGTGCCTGGAAGGCAGAGAGG + Intergenic
1032724718 7:134580197-134580219 ATGGTGTATTGAAGGCAAGGTGG - Intergenic
1034143737 7:148849653-148849675 ATGGTGTTAGGAAGGCAGTGAGG + Intronic
1034199115 7:149270696-149270718 ATGGTGTCTGAAAGCCACTGAGG - Intronic
1034531024 7:151696621-151696643 ATGGTGGGTGGAAGGTTGCGGGG - Intronic
1035314483 7:157989665-157989687 ATGGTCTGGGGGAGGCAGCGGGG + Intronic
1036112647 8:5921027-5921049 AGTGTGTCTGGAATGGAGCGAGG + Intergenic
1036448173 8:8841730-8841752 GTGGGGTCTGGAAGGCTTCGTGG - Intronic
1038724663 8:30069881-30069903 AAGGAGTCTGGAAAGCAGCACGG - Exonic
1039906728 8:41791830-41791852 ATGGTGTCTGGAAGGCAGCGGGG - Intronic
1042668550 8:71234295-71234317 ATGGTGTGTGGAAGGCATCATGG - Intronic
1044829032 8:96227531-96227553 ATGGTGTATGGGAGGAAGCATGG - Intronic
1049414640 8:142489683-142489705 ATGGGGGCTGGAGGGCAGAGTGG - Intronic
1050984846 9:12069540-12069562 ATGGTGTCATGAAAGCAGCAGGG - Intergenic
1051473729 9:17479512-17479534 ATGGTGTTTGGAAGGGATTGGGG + Intronic
1057528924 9:95826980-95827002 AAGGTGTCTGGAAGGCAAGAGGG - Intergenic
1061105082 9:128523774-128523796 CTCGGGTCTGGAAGGCAGCCAGG - Exonic
1062723964 9:138060795-138060817 ATGGTCTCTGGGAGACAGAGCGG + Intronic
1188394324 X:29661925-29661947 ATGGAGGCAGGAAGGCAGGGAGG - Intronic
1190700327 X:52983462-52983484 ATTCTGTCTGGAAGGCTGGGAGG + Intronic
1192504091 X:71670425-71670447 ATGGGGTATGGTAGGCAGAGGGG - Intergenic
1192538633 X:71949818-71949840 TTGGTATGTGGAAGGCAGAGGGG - Intergenic
1194013203 X:88586630-88586652 TTGGTCTCTTGAAGGCAGCATGG - Intergenic
1195091185 X:101460546-101460568 ATGGTGTCTGGAATCCACCAGGG + Intronic
1195268403 X:103206527-103206549 ATGGTTCCTGGAAGGCTGCTTGG + Intergenic
1196556212 X:117087570-117087592 ATTGTCTCTGGATGGCAGAGGGG - Intergenic
1196565402 X:117198386-117198408 ATGGTCTGTGAAAGGCAGCAGGG + Intergenic
1198113913 X:133526589-133526611 ATGGTGTCTGGAAAGCTCTGAGG + Intergenic
1199094343 X:143722634-143722656 CTTGTGTCTGGAGGTCAGCGGGG - Intergenic
1201763320 Y:17560460-17560482 AAAGTGTCAAGAAGGCAGCGGGG + Intergenic
1201838233 Y:18345530-18345552 AAAGTGTCAAGAAGGCAGCGGGG - Intergenic
1202378298 Y:24257223-24257245 TTGGTGACTGGAAGGCTGTGTGG + Intergenic
1202492484 Y:25412898-25412920 TTGGTGACTGGAAGGCTGTGTGG - Intergenic