ID: 1039906729

View in Genome Browser
Species Human (GRCh38)
Location 8:41791831-41791853
Sequence CATGGTGTCTGGAAGGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 0, 3: 44, 4: 384}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039906729_1039906743 17 Left 1039906729 8:41791831-41791853 CCCGCTGCCTTCCAGACACCATG 0: 1
1: 0
2: 0
3: 44
4: 384
Right 1039906743 8:41791871-41791893 TCAGGAAGGAAAACCCTTCCAGG No data
1039906729_1039906740 3 Left 1039906729 8:41791831-41791853 CCCGCTGCCTTCCAGACACCATG 0: 1
1: 0
2: 0
3: 44
4: 384
Right 1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG No data
1039906729_1039906744 29 Left 1039906729 8:41791831-41791853 CCCGCTGCCTTCCAGACACCATG 0: 1
1: 0
2: 0
3: 44
4: 384
Right 1039906744 8:41791883-41791905 ACCCTTCCAGGCGTTCCTATAGG No data
1039906729_1039906739 -1 Left 1039906729 8:41791831-41791853 CCCGCTGCCTTCCAGACACCATG 0: 1
1: 0
2: 0
3: 44
4: 384
Right 1039906739 8:41791853-41791875 GGGGGGCCCAGAGCTTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039906729 Original CRISPR CATGGTGTCTGGAAGGCAGC GGG (reversed) Intronic
900763768 1:4489706-4489728 CTGGGTGGCTGGAAGGCAGGGGG + Intergenic
901951330 1:12749670-12749692 CTTGGAGCCTGGAAGGCAGTGGG + Intronic
902077682 1:13800849-13800871 CATGGTGCCTGGAACAGAGCAGG - Intronic
902176346 1:14653705-14653727 CATGGTGCCTGGGAGACAGTAGG + Intronic
902632559 1:17714069-17714091 AATGGTTTCTGGAAGCAAGCGGG - Intergenic
902859351 1:19233751-19233773 CATGGTCTCTGGAATCTAGCAGG + Intronic
904312420 1:29637575-29637597 CATGGTGAAAGGAAGGAAGCAGG + Intergenic
905403092 1:37717117-37717139 TAGGGTGGCAGGAAGGCAGCTGG - Exonic
905853620 1:41292565-41292587 CATTGTTTCTGGAGGCCAGCAGG - Intergenic
906712767 1:47943892-47943914 CATGGGGCCTGGCAGGCAGTAGG - Intronic
907193522 1:52668071-52668093 CAGGGTGGCTGGGAGGTAGCAGG + Intronic
907719860 1:56961548-56961570 CATGCTGCCTGGAAGGAAACAGG + Intronic
908549786 1:65196937-65196959 CATCGTACCTGGATGGCAGCAGG + Intronic
909481728 1:76133666-76133688 CACAGTTTCTGGAAGTCAGCAGG - Intronic
910549051 1:88455286-88455308 GAAGGTGTTGGGAAGGCAGCAGG + Intergenic
911390223 1:97232220-97232242 CATGGAGTCTGGAAGAAAGTGGG - Intronic
911449245 1:98044465-98044487 CGAGGTGTCTTGAAGGAAGCAGG - Intergenic
911572009 1:99528658-99528680 CATGGTGCCTGGAAAGTAGTAGG - Intergenic
912220116 1:107664602-107664624 CATGGTATCTGGAACATAGCAGG - Intronic
914232111 1:145772546-145772568 CATGGAGGCTAGAAGGCAGTGGG - Intronic
915226736 1:154417257-154417279 CATGGTGTCAGGACCGGAGCTGG - Intronic
915719124 1:157971236-157971258 CATGGAGTCTGAAACCCAGCAGG + Intergenic
916036147 1:160924174-160924196 CATCTTGTGTGGATGGCAGCAGG - Intergenic
917230984 1:172837773-172837795 CATGGTATCTGAAGTGCAGCAGG - Intergenic
917645465 1:177024886-177024908 CATGGTGTCTGTGAGGAAGAAGG - Intronic
918366373 1:183812496-183812518 CATGGTGTCTGGCATAAAGCAGG - Intronic
919834234 1:201562774-201562796 CCTGGTGGATGGAAGGGAGCAGG + Intergenic
919840863 1:201608638-201608660 CCTGGTGTCTGGCAGGATGCTGG + Intergenic
920164458 1:204025926-204025948 CCTGGTGTGTGCCAGGCAGCAGG - Intergenic
920231070 1:204469871-204469893 CATGGTGTCTGGGCGCCTGCAGG + Exonic
921538657 1:216385021-216385043 CATTGTATCTGGCAGGCAGGTGG + Intronic
922375933 1:224965803-224965825 CATGGTGCCTGGCAGGTAGTGGG + Intronic
923851390 1:237799833-237799855 CAAGCAGTCTGGAAGGCTGCAGG + Intronic
923937698 1:238781666-238781688 CATGGTGTCTGGAAGATGGGAGG + Intergenic
924953929 1:248909574-248909596 CATGGCATCTGGCATGCAGCAGG - Intronic
1063173296 10:3529098-3529120 CCTGATGTGTGGAAGGAAGCTGG - Intergenic
1063203216 10:3806009-3806031 CATCTTGTCCTGAAGGCAGCAGG - Intergenic
1063451171 10:6151265-6151287 CAAGGTGTCTGAAGAGCAGCGGG + Intronic
1065081539 10:22134529-22134551 CATGGTTTGTGGATTGCAGCTGG - Intergenic
1065875335 10:29993099-29993121 GATCATGTCTGTAAGGCAGCAGG + Intergenic
1067047053 10:42990775-42990797 ACTGGTGTCTGGAGGGCCGCAGG - Intergenic
1067439132 10:46298595-46298617 CCTGGTGTGTGGAAGGCTGCTGG + Intronic
1067789697 10:49278397-49278419 CAGAGTGCCTGGAAGGCAGATGG - Intergenic
1067934853 10:50601195-50601217 CTTGGTGACTGGAAGGATGCAGG + Intronic
1069284441 10:66695246-66695268 CATGGTGTCTGGGAGTCAGGAGG - Intronic
1069795676 10:71050345-71050367 CATGGTGTTTGGTACACAGCAGG + Intergenic
1070626463 10:78054468-78054490 CAGGGCGGCTGGAAGGCACCTGG + Intronic
1070847906 10:79538962-79538984 CAAGGTGTCTGGCATGTAGCAGG - Intergenic
1070925875 10:80221181-80221203 CAAGGTGTCTGGCATGTAGCAGG + Intergenic
1073057809 10:100713485-100713507 CCTGGAGTCTAGAAGGGAGCGGG + Intergenic
1073062767 10:100742186-100742208 AAGGGTTTCTGGAAGGCAGCGGG + Intronic
1074086372 10:110210991-110211013 CCTGGTTTCTGGAAGGAAGCAGG + Intronic
1074303937 10:112258645-112258667 CATGGTATCAGCATGGCAGCAGG - Intergenic
1074864870 10:117539080-117539102 AATGCTGTCTGGGAGGCAGTGGG - Intergenic
1075728297 10:124621946-124621968 GGTGGTGTCTGCAAGGCAGCCGG + Exonic
1076315088 10:129534211-129534233 CATGGTAAGTGGAAGGCAGGTGG + Intronic
1076356539 10:129857675-129857697 CCTGGTATCTGGATGGCAGTTGG - Intronic
1077049134 11:558894-558916 CGTGGTGTCTGGCAGGCACGTGG + Exonic
1077523120 11:3048020-3048042 CATGGTGTCAGGCAGGCAGGCGG + Intronic
1078425526 11:11247549-11247571 CATTGTGTCTTGCAGGTAGCTGG - Intergenic
1079323373 11:19470976-19470998 CAAAGTGTCTGGAAGGGATCTGG + Intronic
1079649982 11:22915757-22915779 CATGGTTTCTGCAGGTCAGCTGG + Intergenic
1080123277 11:28701878-28701900 AATGGTTTCTGGAATGCAGATGG + Intergenic
1081619052 11:44608019-44608041 CATCTTTTCTGGAAGGCAGGGGG + Intronic
1082725874 11:56736183-56736205 TCTGTTGTCTGGAAGGGAGCGGG - Intergenic
1082783415 11:57303474-57303496 CATGGTGGCTGGGAGGGGGCAGG - Intronic
1082932320 11:58621453-58621475 CATGGCTTTTGGAAGGCAGAAGG - Intronic
1083378919 11:62248412-62248434 GCTGCTGTCTGGGAGGCAGCAGG + Intergenic
1084097504 11:66921403-66921425 CCTGGGGTCTGGGAGGAAGCAGG - Intronic
1085542499 11:77285466-77285488 CATTGTTTCTTGAATGCAGCTGG + Intronic
1086170188 11:83827106-83827128 CATGGTGACTGGAAGGGATGAGG + Intronic
1089030088 11:115317222-115317244 CATGCTGTCTGCAAGGCTGCAGG - Intronic
1089358149 11:117869286-117869308 CAAGCTGCCAGGAAGGCAGCTGG + Intronic
1089445876 11:118551767-118551789 CAAGGTGAGTGGAAGGTAGCAGG - Exonic
1089573495 11:119424897-119424919 CAGTGTGTCTGGAATGCATCAGG - Intronic
1089630487 11:119781235-119781257 CATGGTGTTTGGGAAGCCGCTGG + Intergenic
1090154443 11:124422969-124422991 CAGGGAGTCTGGAAGGGATCTGG - Intergenic
1090808980 11:130220470-130220492 CATGCTGTGTGGGTGGCAGCTGG + Intergenic
1095551485 12:43446705-43446727 AATTGTGTCTTGAAGGCAGCTGG - Exonic
1096230306 12:49893109-49893131 CATGGAGGGTGGAAGGCAGGTGG - Intronic
1096264165 12:50110569-50110591 CCTGGCATCTGGAAGCCAGCAGG + Exonic
1097086421 12:56471707-56471729 CATGGTGGCTGGAGGGTAGGTGG + Exonic
1097427403 12:59463846-59463868 CATGGAGACTAGAAGGCAGTAGG + Intergenic
1098380449 12:69863972-69863994 CATGGAGGCTAGAAGGCAGTGGG - Intronic
1098987677 12:77030028-77030050 CATGCTGTATGGAAGTCTGCAGG - Exonic
1100839999 12:98603311-98603333 CATGGTGGCTTCAGGGCAGCTGG + Intronic
1102311097 12:111844887-111844909 CAAGGTGGCTGGAATGCAGTGGG + Intronic
1102395133 12:112579115-112579137 CATGGTGTCTCAAGGGCAGAAGG + Intronic
1102950427 12:117027379-117027401 CCGGGTGCCTGGAAGGCAGTGGG - Exonic
1103174004 12:118845804-118845826 CATGGTTTCTGGAACACAGTGGG + Intergenic
1103981837 12:124741828-124741850 CACGGGGTCTGGTAGGCAGTTGG - Intergenic
1104094617 12:125545687-125545709 CATGGTGGCAAGATGGCAGCTGG - Intronic
1104682589 12:130761752-130761774 CATGGCGTCTGGTAAACAGCAGG + Intergenic
1104913024 12:132249042-132249064 CTGGGTGTCTGGAAGGTGGCGGG + Intronic
1105209495 13:18249593-18249615 CATGGGCTCTGGCAGGCAGTAGG - Intergenic
1105411459 13:20174777-20174799 CCTGGCGTCTGGAAGGTGGCTGG + Intergenic
1106204253 13:27574876-27574898 CATGGAGACTAGAAGGCAGTGGG + Intronic
1110156414 13:72322332-72322354 CATGCTGTCTGGAAGACGGAGGG - Intergenic
1111260266 13:85728925-85728947 CATCATATCTGGAAGGCAGCAGG + Intergenic
1111854617 13:93622009-93622031 AAGGGTGTCTGGGTGGCAGCTGG - Intronic
1114531956 14:23402101-23402123 CATGTTGTTTGGGAGGCAGTGGG - Intronic
1116033773 14:39603957-39603979 CATAATGTCTGGCAGGGAGCAGG - Intergenic
1116186049 14:41601872-41601894 CATCGTGTCTGAGAGGCAGAAGG - Intergenic
1118386215 14:65257601-65257623 CCTGGGGTCTGGAAGGAAACTGG - Intergenic
1118780422 14:69004255-69004277 CATGCTGTGAGGAAGGCACCTGG + Intergenic
1118900313 14:69980667-69980689 AATGTGCTCTGGAAGGCAGCAGG + Intronic
1119298602 14:73552919-73552941 CATGGGGGATGGAAGGGAGCTGG - Intronic
1119302896 14:73585095-73585117 CATGGGGGATGGAAGGGAGCTGG - Intergenic
1120017710 14:79492874-79492896 CATGCTTTCTGGAAGGAAACAGG - Intronic
1120575259 14:86174087-86174109 CATCTTGTGTGGATGGCAGCAGG - Intergenic
1121261419 14:92569018-92569040 CCTGGTGCCTGTAAGGCACCTGG + Intronic
1121725180 14:96142107-96142129 CATGGTGTCTGACACGCAGCGGG + Intergenic
1121852749 14:97237042-97237064 CATGGGGTATGGTGGGCAGCAGG - Intergenic
1122233932 14:100321638-100321660 CATAGAGTCTGGAAGGAAGGAGG - Intergenic
1123202384 14:106678953-106678975 CACTGTGTCTGGAAAGCATCTGG + Intergenic
1123922699 15:25081675-25081697 CATGGTGTTTGGATAGCATCAGG + Intergenic
1123989466 15:25672868-25672890 CATGGTGCCTGGGAGGGAGAAGG + Intergenic
1124023081 15:25941566-25941588 CGTGGGATCTGGAAGCCAGCTGG + Intergenic
1124601491 15:31136232-31136254 CATGGGGTCACCAAGGCAGCAGG + Intronic
1125284779 15:38080699-38080721 CAAGGTTTCTGGAAGCCATCTGG - Intergenic
1126548483 15:49900218-49900240 CATTATGTCTGGAATCCAGCTGG + Intronic
1127599892 15:60524778-60524800 CATGGTGCCTAGTAGGGAGCAGG - Intronic
1128315709 15:66657938-66657960 CACGGTGCCTGGCAGGCAGTAGG - Intronic
1128352222 15:66898764-66898786 CATGGTGGCTGAAAGGGAGGTGG + Intergenic
1128949163 15:71857473-71857495 CATAGTGGCTGGAAGGGACCTGG - Intronic
1129054539 15:72809568-72809590 CATGCTGGCTGGGTGGCAGCTGG - Intergenic
1129137791 15:73569862-73569884 CATGGGGCCTGAAAGGCAGATGG + Intronic
1129388204 15:75207276-75207298 CATGCCCTCTGGAAGGCACCAGG - Exonic
1129620006 15:77135755-77135777 CATCGTATGTGGATGGCAGCAGG - Intronic
1129679155 15:77648223-77648245 CACAGTGCCTGGAACGCAGCCGG - Intronic
1131856871 15:96606368-96606390 CATGGTGCCTCAAAGGCACCAGG - Intergenic
1132983076 16:2749213-2749235 CATGGGGCCTGGAAGCCAGAAGG + Intergenic
1132991268 16:2796181-2796203 AACGGTGTCTGGGAGGCAGGGGG - Intergenic
1133256861 16:4522429-4522451 CATGGCGTCAGGACGCCAGCTGG + Intronic
1135801705 16:25503388-25503410 CATGGTACCTGGAAATCAGCAGG - Intergenic
1136417497 16:30112846-30112868 CATGGTGGCTGGGAGGTGGCCGG + Intronic
1136593020 16:31229074-31229096 CATGGTGTCTGGAGGGATGGTGG + Intergenic
1138055663 16:53830601-53830623 CAAGGAGCCAGGAAGGCAGCTGG + Intronic
1138916301 16:61468962-61468984 CATGGTTGCTGGTAGCCAGCTGG + Intergenic
1139752378 16:69117089-69117111 CATGAAGGCTGGAAGGCAGCAGG + Exonic
1141873743 16:86807173-86807195 CAAGGAGGCTGGAAGGCAGCGGG + Intergenic
1143001089 17:3795450-3795472 CGTGGTGCCTGGAAGGCAACAGG - Intronic
1143252073 17:5530755-5530777 CATGGGGTCTGGCATCCAGCAGG - Intronic
1143413543 17:6728050-6728072 CCTGCTGTCCAGAAGGCAGCAGG - Intergenic
1146063601 17:29619423-29619445 CTTGGTGCCTGGAGAGCAGCAGG - Intronic
1146206232 17:30907516-30907538 GTTTGTGTCTGGAAGGCAGTGGG + Intronic
1147242736 17:39101319-39101341 CAGGGTGTCTGTCAGACAGCAGG - Intronic
1147916148 17:43888143-43888165 CATAGTGCCTGGCAGACAGCAGG + Intronic
1149081300 17:52660846-52660868 CACAGTGTCTGGCATGCAGCAGG + Intergenic
1150951101 17:69802640-69802662 CATGGTAGCTGGCAGGCAACTGG + Intergenic
1151501129 17:74489740-74489762 CATCTTGTGTGGATGGCAGCAGG + Intergenic
1151703636 17:75755857-75755879 CATGGTGGCTGCCAGGCTGCGGG + Intronic
1151920388 17:77150382-77150404 CAGGGTATCTGGAAGGGAGAGGG - Intronic
1151954452 17:77373478-77373500 CATGATGGCTGGTGGGCAGCGGG - Intronic
1152739948 17:82014476-82014498 CATGGTGTCTGGGAGGGAGGTGG - Intronic
1152840339 17:82563482-82563504 CATGGTGTCTGGAATGTTGATGG - Exonic
1153143062 18:1996887-1996909 CTTGGTGTTTGGAAGGCTGAAGG + Intergenic
1153840748 18:9005782-9005804 CATGGGGTCTGCAGTGCAGCAGG - Intergenic
1154256394 18:12784353-12784375 CATGGTGTCCGCAAAGCTGCTGG - Intergenic
1156584768 18:38420033-38420055 CATGGTGCCTAGCAGGCAGCAGG - Intergenic
1156933599 18:42675606-42675628 CATGGTGTCTTCTAGGCACCTGG + Intergenic
1158205699 18:54990349-54990371 CAAGCTGTCTGCAAGGCAGTGGG - Intergenic
1158907987 18:62032385-62032407 CATGCCATCTGGAACGCAGCTGG + Intergenic
1160345408 18:78128185-78128207 AATGGTGACTGGCAGGCAGGTGG - Intergenic
1160942244 19:1625738-1625760 CCTGGGGTCTGGATGCCAGCTGG - Intronic
1161370448 19:3908310-3908332 GCTGCTGTCTGGAAGGAAGCAGG - Exonic
1162069164 19:8143283-8143305 CAAGTTGTCTGGGAAGCAGCTGG - Intronic
1162111500 19:8402307-8402329 AGAGGTGTCTGGAAGGCAGGAGG + Intronic
1162939132 19:13997569-13997591 TCTGGAGGCTGGAAGGCAGCAGG - Intronic
1163528559 19:17836044-17836066 CATGGTGCCTGGTTGGCAGCAGG + Exonic
1164621172 19:29696868-29696890 CAGGGTGTCTGGGTGGCAGAGGG + Intergenic
1164621330 19:29697554-29697576 CAGGGTGTCTGGGTGGCAGAGGG - Intergenic
1166337083 19:42114779-42114801 CATGGTGCCTGGAAGAAAGGTGG + Intronic
1167190475 19:47985305-47985327 CATGGTTTCTGGAAAGAAGTTGG - Intronic
1167512531 19:49903349-49903371 GATGGTGTCTGGAGGGGAGACGG + Intronic
1167702278 19:51056549-51056571 CATGGTGACAGGATGGAAGCCGG + Exonic
1167732388 19:51268058-51268080 CAGGGTGTTAGGAGGGCAGCAGG - Intronic
1167831150 19:52023836-52023858 CATGGCCTCAGGAAGGGAGCTGG + Intronic
1168063876 19:53908705-53908727 CCTGGGGTCTGGACGGCTGCAGG - Intergenic
1168137795 19:54363136-54363158 CCTGGGGTCAGGAAGGGAGCAGG + Intronic
1168160226 19:54505497-54505519 CCTGGGGTCAGGAAGGGAGCAGG - Intronic
1168687754 19:58358585-58358607 CCTGGGGACAGGAAGGCAGCAGG + Exonic
925009532 2:471611-471633 CCTGGTGTCTACAAGGCAGAAGG + Intergenic
925349433 2:3190489-3190511 CATGGTTTCCTGAATGCAGCAGG + Intronic
927481106 2:23454832-23454854 CATAGTGTCTGGTGGGCAGGAGG - Intronic
927713574 2:25340169-25340191 CATGGCGTCTGGCACCCAGCAGG - Intronic
928225291 2:29443237-29443259 CATGGTGCCTGCCAGGGAGCAGG + Intronic
928398434 2:30960870-30960892 AAGGGTGTGGGGAAGGCAGCTGG - Intronic
928598211 2:32877474-32877496 CACGGTCTCTGAAAGACAGCTGG - Intergenic
929037501 2:37708615-37708637 CATGGTGTCTGGCACACAGTAGG - Intronic
929878062 2:45813507-45813529 CATGGTGTCTGCCAGGGAGCTGG - Intronic
932216119 2:69967033-69967055 CATGGTGTCTGGCACACAGTAGG - Intergenic
932734834 2:74247300-74247322 CATTGCCTCTGGAAGGCAGAGGG + Exonic
933779140 2:85789263-85789285 CTTAGTGTCTGACAGGCAGCTGG - Intergenic
934200075 2:89877304-89877326 CATGGTCTCAAGAAGGCTGCAGG - Intergenic
934495796 2:94796728-94796750 AAGGGTGTGTGGAAGGCAGAAGG - Intergenic
935782216 2:106518126-106518148 CATGGTGTCTTGTATGCAGTGGG + Intergenic
935898344 2:107762472-107762494 GATGGTTTCTGGAAGTCTGCTGG - Intergenic
936600728 2:113891278-113891300 GATGGTATCTTGAAGGAAGCAGG + Intronic
936657540 2:114505720-114505742 CAGGGTGTGGGGCAGGCAGCTGG - Intronic
936711888 2:115141334-115141356 CACGGTGTCTGGAATATAGCAGG - Intronic
937074182 2:119089084-119089106 CAAGGAGTAAGGAAGGCAGCAGG + Intergenic
937156391 2:119722613-119722635 CATGGTGTCTGATATACAGCAGG + Intergenic
937263688 2:120602611-120602633 CGTGGAGGCTGGGAGGCAGCTGG - Intergenic
937671520 2:124542510-124542532 CCTGGAGGCTGGAAGGCAGCTGG - Intronic
940211227 2:151258321-151258343 CATGCTGTAATGAAGGCAGCTGG + Intronic
940282352 2:152000999-152001021 CATGGTGTCTGGTATGCAGTAGG - Intronic
940450177 2:153827133-153827155 CATCTTATGTGGAAGGCAGCAGG + Intergenic
942181937 2:173388496-173388518 CAGAGGGTCTGGAAGGAAGCAGG + Intergenic
942986169 2:182144987-182145009 CATGGTGTCTGGGAGACAACAGG - Intronic
943483837 2:188455499-188455521 CATCCTGTGTGGATGGCAGCAGG - Intronic
944442613 2:199757701-199757723 CATGGAGTATGCATGGCAGCTGG + Intergenic
944680829 2:202075154-202075176 CCTGGCATATGGAAGGCAGCAGG + Exonic
945295368 2:208165565-208165587 CATTGTGACTGGAAGACTGCTGG - Exonic
946099994 2:217312083-217312105 CATGGTGCCTCGATGGCACCTGG + Intronic
946145752 2:217729680-217729702 CATTGTGACTTGAAGGCAGCAGG - Intronic
947722576 2:232378786-232378808 CAGCATGTCTGGAGGGCAGCAGG - Exonic
947886378 2:233575478-233575500 CATGTTATGTGGATGGCAGCAGG + Intergenic
948076470 2:235168693-235168715 AATGGGGCCAGGAAGGCAGCAGG + Intergenic
948725482 2:239931227-239931249 CAAGGTGTCTGCAGGGCTGCAGG + Intronic
948743782 2:240070146-240070168 TTTGGTGGCTGCAAGGCAGCTGG + Intergenic
948807118 2:240457806-240457828 CAGGGTGGCTGGAATGCAGCAGG - Intronic
1169242265 20:3993626-3993648 CAAGGTCCATGGAAGGCAGCAGG - Intronic
1169543131 20:6622188-6622210 CATGGTCTGAGGAAGGAAGCTGG + Intergenic
1169967104 20:11229933-11229955 CTTGGTATTTGGCAGGCAGCTGG - Intergenic
1170152771 20:13242589-13242611 CCTGGTCTCTTGATGGCAGCTGG + Intronic
1170291322 20:14772458-14772480 CATGTTATGTGGATGGCAGCAGG + Intronic
1170629256 20:18054340-18054362 CCTGGGGTGTGCAAGGCAGCAGG - Intronic
1170899246 20:20444564-20444586 GAGAGTGTCTGGAAAGCAGCAGG - Intronic
1171973103 20:31576941-31576963 CATGGTTTTGGGAAGGCAGTAGG - Intronic
1172166285 20:32901553-32901575 AATGAGGTCAGGAAGGCAGCAGG - Intronic
1173253302 20:41375783-41375805 AAGGCTGTCTGGAGGGCAGCAGG + Intergenic
1173379838 20:42530341-42530363 CATGGTGCCTGGCATGCAGCGGG - Intronic
1173445599 20:43115243-43115265 GAAGGTGCCTGGAAGACAGCAGG + Intronic
1173825751 20:46046703-46046725 CAGGGAGGCTGGAAGTCAGCTGG + Intronic
1174013525 20:47469826-47469848 CTCAGTGTCTGGAAGGCATCAGG + Intergenic
1174043502 20:47716603-47716625 CTTGTTTACTGGAAGGCAGCAGG + Intronic
1174301953 20:49588973-49588995 CATGGTGTCTGGAACATGGCAGG - Intergenic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175605363 20:60308233-60308255 CCTGGTGCGTGGAAGGCAGAAGG - Intergenic
1175974627 20:62704356-62704378 CCTGGTGGCTGCAGGGCAGCTGG - Intergenic
1178432631 21:32529916-32529938 CATGGTGTCTGGCACAGAGCAGG - Intergenic
1178851977 21:36220009-36220031 AGTGGTGTTTGGAAGACAGCGGG + Intronic
1179543542 21:42099976-42099998 GCTTGTGTCAGGAAGGCAGCCGG + Intronic
1180581940 22:16846089-16846111 CCTGGTGTGTGGAGGGCAGGGGG - Intergenic
1180712278 22:17847465-17847487 CAGGGTGTCTGGCTGGAAGCAGG - Intronic
1180753805 22:18146130-18146152 CATGTTATCTGTAAGGAAGCCGG - Intronic
1181104517 22:20565919-20565941 CCCGGTGTCAGGAAGGCAGCTGG + Intronic
1181751538 22:24992288-24992310 CATGGTGACTGGTAGGCTCCGGG + Intronic
1183187659 22:36301202-36301224 CACGATGTCTGGAAGGTACCTGG - Intronic
1183300806 22:37058220-37058242 CATGGAGACTGCAAGGCAGAAGG + Intronic
1183356922 22:37364552-37364574 CATGGAGGCAGGAAGGGAGCAGG + Intergenic
1183406898 22:37634627-37634649 CAGGGTGTCTGGAAGCCTCCAGG - Intergenic
1183714835 22:39527552-39527574 GCAGCTGTCTGGAAGGCAGCAGG - Intergenic
1184482942 22:44758734-44758756 CATGAGCTCTGGAGGGCAGCAGG + Intronic
1184920971 22:47605733-47605755 CCTGGTGTCTGGCACGCTGCCGG - Intergenic
1184978124 22:48077558-48077580 TGTGGTGTCTTGGAGGCAGCTGG + Intergenic
1185182372 22:49370819-49370841 CATTGTCTCTGGAAAGCTGCGGG + Intergenic
1185182761 22:49372692-49372714 CCTGCTGACTGGAAGGCTGCAGG - Intergenic
1185317202 22:50184342-50184364 CCTGGAGCCTGGAAGGAAGCAGG + Intergenic
1185325780 22:50225257-50225279 CCTGGTGCCTGGTGGGCAGCAGG - Intronic
1185369871 22:50456052-50456074 TCTGGTGCCTAGAAGGCAGCTGG - Intronic
949835272 3:8262193-8262215 CATGAAGGCTGGAAGGCAGTGGG - Intergenic
950697877 3:14717601-14717623 CATGCTGTCTTGGAGGCTGCAGG + Intronic
950864326 3:16176602-16176624 CATGGTGACAGTAAGGGAGCAGG - Intronic
952767786 3:36969963-36969985 AATGGTGCCTGCCAGGCAGCAGG - Intergenic
952990534 3:38827464-38827486 CATGGTTTCTTGAAGGCAGTAGG + Intergenic
954196477 3:49000043-49000065 CATGGTTTCTGGAACACAGCAGG + Intronic
954375261 3:50191242-50191264 CCTGGTGCCGGGCAGGCAGCAGG + Intergenic
954419553 3:50411453-50411475 CACTGTGTCTGGAATGGAGCTGG - Intronic
954660585 3:52224800-52224822 CAGGGTCCCTGGGAGGCAGCCGG - Intronic
954662564 3:52233947-52233969 CATCTTGTCTGGGAGGCAACAGG + Intronic
954842847 3:53527205-53527227 CATAGTGGCTGGAAGGTTGCAGG + Intronic
955058580 3:55476982-55477004 CATGGTGCCTCCAAGGCAACTGG + Intronic
955523684 3:59799521-59799543 CAACGTGTCTGGAAACCAGCTGG + Intronic
955606072 3:60705805-60705827 GATGGTGTGTGGAGGACAGCTGG - Intronic
956316640 3:67945241-67945263 ATTTGTGTCTGGAAGGGAGCAGG - Intergenic
958114230 3:89194376-89194398 CATTGTTTCTGCAAGGCAGAAGG - Intronic
959894687 3:111593120-111593142 CAGGGTGTCTGCAAGTGAGCTGG + Exonic
960704457 3:120468730-120468752 GAAGATGCCTGGAAGGCAGCAGG + Intergenic
960844175 3:121991794-121991816 CATGGTGTGTGCAAAGGAGCAGG - Intronic
961436140 3:126918377-126918399 CATGGTGTCTGGCAAACAGCAGG - Intronic
961752837 3:129107460-129107482 CAAGGTGTTTGGGTGGCAGCAGG - Intronic
962331244 3:134480642-134480664 CATGGTCTCTGGTATCCAGCAGG - Intronic
962384218 3:134919969-134919991 TATGGAGCCTGGTAGGCAGCTGG - Intronic
962531093 3:136280974-136280996 CATGGAGGCCGGAAGGCAGTGGG - Intronic
962851392 3:139310875-139310897 CACGGTGTCTGGCAAACAGCAGG - Intronic
964710424 3:159665944-159665966 CATGGAGACTGGAAGGCAGGAGG - Intronic
965666491 3:171099495-171099517 CATGGTGTCTGGAATACAGTGGG - Intronic
966989522 3:185214986-185215008 CATCCTGTCTAGAAGGCAGCTGG - Intronic
968829654 4:2926454-2926476 CACGGTGGCTGAGAGGCAGCCGG - Intronic
969054616 4:4393829-4393851 GATGGGGTCTGGGAAGCAGCAGG - Intronic
969058311 4:4415611-4415633 CACGTTGTCTGGGAGGCATCTGG + Intronic
969253011 4:5982370-5982392 CATGATGTCTGCTAGACAGCAGG - Intronic
969969341 4:11029447-11029469 CAGAGGGTTTGGAAGGCAGCTGG + Intergenic
970842503 4:20490962-20490984 CATGGTTTCTGGAAGACAGTGGG - Intronic
970885712 4:20985527-20985549 CATAGTGACTGGAAGGCAACAGG + Intronic
970984626 4:22142082-22142104 TATGGTTTGTGGAAGGCACCTGG + Intergenic
971135693 4:23865521-23865543 CATGGTGTCTGGGACACAGTAGG + Intronic
971401367 4:26278861-26278883 CATGATATCTGGCAGGCATCAGG + Intronic
972382210 4:38529593-38529615 CATGGTATCCTGAAGGCAGTGGG + Intergenic
972506262 4:39723124-39723146 CCTGGAGTCTGGAAGGCAGGGGG - Intronic
972583933 4:40419479-40419501 CCTGGGGCCAGGAAGGCAGCAGG + Intergenic
972703724 4:41519292-41519314 CATGATGTCTGGACTGAAGCTGG - Intronic
972896585 4:43628936-43628958 CATAGTGTCTCCAATGCAGCAGG + Intergenic
977028456 4:91851727-91851749 CAGGGTCTTTGGAAGGCTGCGGG - Intergenic
977253525 4:94715002-94715024 CATGGTTTCTGGAAAGCTGAGGG + Intergenic
978097277 4:104793368-104793390 CATTGTGTCTGGCAGGAAGGTGG + Intergenic
978979266 4:114922045-114922067 CCTGGTGACTGGAAGGCGGTGGG - Intronic
980878506 4:138686254-138686276 CATGGAGCCTGGAAGGCACAGGG + Intergenic
981241893 4:142487156-142487178 CTTGCTGCCTGGATGGCAGCAGG - Intronic
981937049 4:150249681-150249703 CATGGTGAGTGGAAGGCGGCAGG + Exonic
983111691 4:163758195-163758217 GAGGGAGTCTGGAAGGCAGAAGG + Intronic
984287544 4:177751781-177751803 CATGTTGCATGGATGGCAGCAGG + Intronic
986519515 5:8599129-8599151 CCTGGTGTCTGGCATGGAGCTGG - Intergenic
990389855 5:55307757-55307779 CCTGGCGTGTGGCAGGCAGCTGG - Exonic
990681024 5:58244660-58244682 CATGGTTATGGGAAGGCAGCTGG - Intergenic
992533072 5:77671030-77671052 CATGGTGCCTGGCACACAGCAGG + Intergenic
994193380 5:96894153-96894175 CATGGTGCCAGGAACGCAGTAGG + Intronic
994261625 5:97665911-97665933 CATGGAATCTCAAAGGCAGCAGG - Intergenic
995541558 5:113190964-113190986 CATGGTGCCTGGCACGAAGCAGG + Intronic
996899501 5:128528229-128528251 CATAGTTTCTGGAAAGCAGGAGG + Intronic
998604449 5:143619238-143619260 CATGAGGTCAGAAAGGCAGCTGG - Intergenic
1002192378 5:177485034-177485056 CGTGGTGCAGGGAAGGCAGCTGG - Intronic
1002321196 5:178377078-178377100 CATGGGGTCTGACAGGGAGCCGG + Intronic
1003051319 6:2783315-2783337 CAGGCTTTCTGGAAGTCAGCTGG + Intronic
1003505515 6:6737173-6737195 CATGGTGTAAGGAAGCCACCAGG + Intergenic
1003535713 6:6973713-6973735 CCTGGAGGCTGGAAGGTAGCTGG - Intergenic
1003680198 6:8245090-8245112 CATGGTGTGGGGGAGGCTGCAGG + Intergenic
1003701000 6:8465273-8465295 CACAGTGTCTGGCAGGTAGCAGG - Intergenic
1004367837 6:15027006-15027028 CATGGAGTCTGGAAAGCTGGAGG + Intergenic
1005922393 6:30414341-30414363 CATCTTGTGTGGATGGCAGCAGG + Intergenic
1006287371 6:33106969-33106991 GATGGTGTCTGGAGGGCAAGGGG - Intergenic
1006389955 6:33752374-33752396 CCTCGTGCCTGGAAGGCAGGTGG - Intergenic
1006398308 6:33801403-33801425 CCTGGTGTGTGGCAGGGAGCTGG - Intronic
1007555460 6:42762036-42762058 CGTGGTGACTGGAAGGCAGAAGG - Intronic
1007935389 6:45727951-45727973 CATGGTGTCTTGTATGCACCTGG + Intergenic
1009626994 6:66146897-66146919 CATGAGGTGTGGAATGCAGCAGG - Intergenic
1010089954 6:71969008-71969030 CTTGGTGTTTTGCAGGCAGCAGG - Exonic
1013279551 6:108622826-108622848 CATGATGTCTGCAAGAGAGCCGG + Intronic
1013403931 6:109825533-109825555 CATGGTGCCTGGCACACAGCAGG - Intergenic
1013658497 6:112270384-112270406 CAGTGTGTCTGGTGGGCAGCTGG + Intergenic
1016649728 6:146449512-146449534 CATCTTATGTGGAAGGCAGCAGG + Intergenic
1017257814 6:152353609-152353631 CCTGGTATCTGGAAGTCAGCTGG + Exonic
1018742168 6:166738319-166738341 CCAGTGGTCTGGAAGGCAGCAGG + Intronic
1019091313 6:169537181-169537203 TATAATGTCTGGGAGGCAGCTGG - Intronic
1019177507 6:170167721-170167743 GGTGGTGTCCGGAAGGCTGCAGG - Intergenic
1019616458 7:1965096-1965118 CATGGTGTCTGGCTCACAGCAGG + Intronic
1019671227 7:2280149-2280171 CTTCTTGTCTGTAAGGCAGCTGG - Intronic
1019923035 7:4174831-4174853 GAAGCTGTCTTGAAGGCAGCTGG - Intronic
1021761532 7:23906722-23906744 CCAAGTGTGTGGAAGGCAGCAGG + Intergenic
1021843324 7:24740942-24740964 CATGGTCTCTGGAAAACAGCCGG + Intronic
1022374066 7:29797058-29797080 AAAGGTGTCTGGGAGGCAGAAGG + Intergenic
1022496475 7:30856060-30856082 CAAGGTGTCTGGCAGGCTCCTGG + Intronic
1023098875 7:36692193-36692215 CATGGTGCCTGGCATGGAGCAGG + Intronic
1023365920 7:39463416-39463438 GCTGGTGTTTGGAAGGCAGGAGG + Intronic
1023644229 7:42292647-42292669 CATGTTGTCTGGAACACAGTAGG + Intergenic
1023892113 7:44400363-44400385 CAGGTTATGTGGAAGGCAGCTGG + Intronic
1024314888 7:48006646-48006668 AATGGGGTCTGGAGGGCGGCAGG + Intronic
1025938262 7:66054377-66054399 CATGGTGGCTTGGAGGCAGCTGG - Intergenic
1028743343 7:94301118-94301140 CATTGTGCCTTTAAGGCAGCAGG + Intergenic
1029439902 7:100581882-100581904 CCTGGTATCAGGAAGGCAGTGGG + Exonic
1029441530 7:100589640-100589662 CATGGTGTGGGAAAGCCAGCAGG + Exonic
1029848730 7:103440971-103440993 CACTGTGTATGGAAGGCTGCAGG + Intronic
1030028293 7:105346384-105346406 CATGGTGACTGGAACACAGAGGG + Intronic
1030401033 7:109050183-109050205 CATGTTCTTTGCAAGGCAGCAGG - Intergenic
1031077777 7:117229266-117229288 GCTGGTGTCTGGGAGGCAGTAGG + Intronic
1032989559 7:137377613-137377635 CATGGAGTCCAGAAGGCAGCAGG - Intergenic
1033051137 7:138005522-138005544 AATGGTGTCTGGAATTAAGCAGG - Intronic
1033111634 7:138583669-138583691 CAGTGTGTGTGGAAGGCAGTGGG + Intronic
1033282417 7:140015591-140015613 CATGGTGTGTGGAATGAGGCTGG - Intronic
1033486949 7:141799931-141799953 CATAGTACCTGGATGGCAGCAGG - Intergenic
1034445068 7:151109893-151109915 CATGGTGCCTGGCGTGCAGCGGG - Intronic
1034692510 7:153025105-153025127 AGAGGTGTCTGGGAGGCAGCTGG + Intergenic
1035314482 7:157989664-157989686 CATGGTCTGGGGGAGGCAGCGGG + Intronic
1035574096 8:693914-693936 CACACTGTCTGGAAGGTAGCAGG + Intronic
1038130626 8:24727184-24727206 CATGGTATCTGGAAAACAGCAGG - Intergenic
1038405778 8:27321508-27321530 CATGGTGGCTGGACGGCATTAGG + Intronic
1038494534 8:27992198-27992220 CATGCTGTCTCAAAGACAGCTGG - Intronic
1039405180 8:37306601-37306623 CCTGGTGCCTGGCAGGAAGCTGG + Intergenic
1039427830 8:37501293-37501315 TCTGGTGTCTGGAACGTAGCAGG - Intergenic
1039497071 8:37988339-37988361 CATGGTCACTGGAAGGCTGTGGG - Intergenic
1039817316 8:41105973-41105995 CATGATGTCAGGAACGCATCTGG + Intergenic
1039906729 8:41791831-41791853 CATGGTGTCTGGAAGGCAGCGGG - Intronic
1040605506 8:48927597-48927619 CGTGGTGTCTGACAGGCAGGTGG + Intergenic
1040807028 8:51406409-51406431 CATGGTAACTGGCAGGCATCTGG - Intronic
1044959142 8:97512907-97512929 CATGATGTCTGGATCTCAGCTGG - Intergenic
1047504305 8:125466755-125466777 CTTGGACTGTGGAAGGCAGCTGG + Intergenic
1048518396 8:135131696-135131718 CATGGCGACTGGAAGCCAGAAGG - Intergenic
1048891901 8:138955713-138955735 CAGGAAGACTGGAAGGCAGCAGG + Intergenic
1049005376 8:139852145-139852167 CATCATCTGTGGAAGGCAGCAGG - Intronic
1049463559 8:142740974-142740996 CGTGGGGTATGGAAGGCAGAGGG + Exonic
1049609038 8:143544335-143544357 GATGGGGTCTGCAAGGCAGCAGG - Intergenic
1049640028 8:143711311-143711333 CATTGTGTTAGGAAGGCAGGCGG + Intronic
1049757117 8:144315643-144315665 CAAGGTGTCCTGAAGGCTGCAGG + Exonic
1050131457 9:2417071-2417093 CATGATGTAGGGAAGGCATCAGG + Intergenic
1050984847 9:12069541-12069563 CATGGTGTCATGAAAGCAGCAGG - Intergenic
1051930043 9:22374124-22374146 CATATTGCCTGGAAGGCAGGCGG + Intergenic
1052993823 9:34538975-34538997 CCTGTTGACTGGGAGGCAGCAGG - Intergenic
1053456302 9:38235469-38235491 CATGGTGGCAGCAGGGCAGCTGG + Intergenic
1054945751 9:70794438-70794460 CATGTTGCCAGGAAGGGAGCAGG - Intronic
1056133231 9:83605832-83605854 CGGGGTTTCTGGAAAGCAGCTGG - Intergenic
1056487028 9:87069410-87069432 CACAGTGTCTGGAAGACAGAAGG + Intergenic
1057003220 9:91531977-91531999 CATGGTGTTTGGCATGCAACAGG + Intergenic
1057282290 9:93721625-93721647 CCTGGTGTGTGGGAGGCTGCTGG + Intergenic
1057528925 9:95826981-95827003 CAAGGTGTCTGGAAGGCAAGAGG - Intergenic
1057878217 9:98773803-98773825 CATGGTGTGTTCCAGGCAGCGGG - Intronic
1059449228 9:114359851-114359873 CAGGGTGTCTGGCCAGCAGCTGG - Intronic
1059767510 9:117397539-117397561 CATGGTTTATGGAAGACAGATGG + Intronic
1060828885 9:126701712-126701734 CAAGGTGACTGGATGGAAGCAGG + Intergenic
1061048582 9:128180814-128180836 CATAGTTTCTGAAAGGAAGCAGG - Exonic
1061619464 9:131802187-131802209 GATGGTGTCTGGCATTCAGCAGG - Intergenic
1189344168 X:40228015-40228037 CATGGTGAGTGGCAGGAAGCAGG + Intergenic
1191673510 X:63770812-63770834 CATTGTATGTGGATGGCAGCAGG - Intronic
1192414010 X:70961492-70961514 CATGCAGGCTGGAGGGCAGCTGG + Intergenic
1192504092 X:71670426-71670448 CATGGGGTATGGTAGGCAGAGGG - Intergenic
1192538634 X:71949819-71949841 CTTGGTATGTGGAAGGCAGAGGG - Intergenic
1193403687 X:81076915-81076937 CATGGGGTGTGGAGGGCAGGGGG + Intergenic
1193561170 X:83017482-83017504 CATGGAGGCTGGAAAGCAGTGGG + Intergenic
1195091184 X:101460545-101460567 CATGGTGTCTGGAATCCACCAGG + Intronic
1196170654 X:112584673-112584695 CATCTTGTGTGGATGGCAGCAGG + Intergenic
1196556213 X:117087571-117087593 CATTGTCTCTGGATGGCAGAGGG - Intergenic
1196565401 X:117198385-117198407 TATGGTCTGTGAAAGGCAGCAGG + Intergenic
1197090114 X:122526212-122526234 ATGGGTCTCTGGAAGGCAGCTGG - Intergenic
1197186281 X:123590756-123590778 CCTGGTGTCTTGAATGCAGAGGG + Intergenic
1198118175 X:133564708-133564730 CATGGTGTCTGGCACACAGTAGG + Intronic
1198666922 X:139034575-139034597 TATGGTGTCTGGAGCCCAGCAGG + Intronic
1199094344 X:143722635-143722657 CCTTGTGTCTGGAGGTCAGCGGG - Intergenic
1201959241 Y:19660526-19660548 CATCTTATGTGGAAGGCAGCAGG + Intergenic