ID: 1039906730

View in Genome Browser
Species Human (GRCh38)
Location 8:41791832-41791854
Sequence CCATGGTGTCTGGAAGGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 1, 2: 5, 3: 49, 4: 463}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039906730_1039906743 16 Left 1039906730 8:41791832-41791854 CCGCTGCCTTCCAGACACCATGG 0: 1
1: 1
2: 5
3: 49
4: 463
Right 1039906743 8:41791871-41791893 TCAGGAAGGAAAACCCTTCCAGG No data
1039906730_1039906740 2 Left 1039906730 8:41791832-41791854 CCGCTGCCTTCCAGACACCATGG 0: 1
1: 1
2: 5
3: 49
4: 463
Right 1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG No data
1039906730_1039906739 -2 Left 1039906730 8:41791832-41791854 CCGCTGCCTTCCAGACACCATGG 0: 1
1: 1
2: 5
3: 49
4: 463
Right 1039906739 8:41791853-41791875 GGGGGGCCCAGAGCTTTCTCAGG No data
1039906730_1039906744 28 Left 1039906730 8:41791832-41791854 CCGCTGCCTTCCAGACACCATGG 0: 1
1: 1
2: 5
3: 49
4: 463
Right 1039906744 8:41791883-41791905 ACCCTTCCAGGCGTTCCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039906730 Original CRISPR CCATGGTGTCTGGAAGGCAG CGG (reversed) Intronic
900111249 1:1006467-1006489 CCATGGGATCTGGAGGGGAGGGG + Intergenic
900320285 1:2080107-2080129 CCCTGGGACCTGGAAGGCAGAGG - Intronic
900373674 1:2343779-2343801 CCATGGTGTTTAGAAGCCTGGGG - Intronic
900461525 1:2804349-2804371 CTCAGGTGTCTGGAGGGCAGGGG - Intergenic
900763767 1:4489705-4489727 GCTGGGTGGCTGGAAGGCAGGGG + Intergenic
901612691 1:10511650-10511672 CCACGGTCTATGGAAGTCAGAGG - Intronic
901648067 1:10727230-10727252 CCAGGGCGTCTTGCAGGCAGGGG + Intronic
901951329 1:12749669-12749691 CCTTGGAGCCTGGAAGGCAGTGG + Intronic
903122519 1:21225539-21225561 CCATGGTGGCTGGAGGACGGGGG - Intronic
903501372 1:23801712-23801734 CCATAGTGACTGGAAATCAGTGG - Intergenic
904748409 1:32725460-32725482 CCATGGGGGCAGGAAGGGAGAGG + Intergenic
905914218 1:41674012-41674034 CCCTGGTGTCAGAGAGGCAGGGG - Intronic
906158077 1:43625835-43625857 CTGTGGTGGCTGGAGGGCAGGGG - Intergenic
906253860 1:44332464-44332486 CCATGGTGTGTAGCAGGCTGTGG - Intronic
906659314 1:47571378-47571400 GCATGGAGGCTGGGAGGCAGGGG - Intergenic
906715536 1:47965696-47965718 ACATGGTGTCATGAAGGAAGAGG - Intronic
907927005 1:58964617-58964639 CCATGGTGTGTGCCAGGCTGTGG + Intergenic
908041663 1:60120308-60120330 CCATGGGACCTGGGAGGCAGAGG + Intergenic
908562545 1:65321238-65321260 CCAAGCTGGCTGGAATGCAGTGG + Intronic
908613334 1:65887499-65887521 CTCTGGAGTCTGGGAGGCAGAGG - Intronic
909581518 1:77241120-77241142 CCATTGAGTCTGGAATGGAGAGG - Intergenic
910684318 1:89900914-89900936 CCATGGCGACTGGAGGCCAGAGG + Intronic
910934818 1:92479199-92479221 CCATGGGGTGTGGAAGGTTGTGG - Intronic
911390224 1:97232221-97232243 CCATGGAGTCTGGAAGAAAGTGG - Intronic
911468793 1:98290110-98290132 CCCTGGGGTCTGTAAGACAGGGG - Intergenic
911923126 1:103792690-103792712 CCATGCTGGCTGTCAGGCAGGGG - Intergenic
912405327 1:109433087-109433109 ACAGGGGGTCTGGAAGGCAAAGG + Intergenic
913608648 1:120489852-120489874 GCATGGTTCCTGGAAGGCAAGGG + Intergenic
913986777 1:143572820-143572842 GCATGGTTCCTGGAAGGCAAGGG - Intergenic
914232112 1:145772547-145772569 CCATGGAGGCTAGAAGGCAGTGG - Intronic
914370392 1:147019630-147019652 GCATGGTTCCTGGAAGGCAAGGG + Intergenic
914484302 1:148093780-148093802 GCATGGTTCCTGGAAGGCAAGGG - Intergenic
914582550 1:149031986-149032008 GCATGGTTCCTGGAAGGCAAGGG - Exonic
915248478 1:154572213-154572235 CCCGGGTATCTGGAAAGCAGCGG + Intronic
915423763 1:155806670-155806692 GCATGGTGACTGGAGTGCAGTGG - Intronic
917235591 1:172888585-172888607 TTCTGGGGTCTGGAAGGCAGTGG + Intergenic
919088131 1:192946025-192946047 TCATGATCTGTGGAAGGCAGAGG - Intergenic
919769232 1:201146711-201146733 CCAGGGTCTCAGGAAGCCAGTGG - Intronic
919818286 1:201455862-201455884 CCAGGGTGCCTGGAAGGATGTGG - Intergenic
919877193 1:201878245-201878267 CTATGGAGTCTGCAAGGCCGAGG - Exonic
919969556 1:202565469-202565491 ACATGGAGTTTGGAGGGCAGGGG + Intronic
921359068 1:214313745-214313767 CCATGGTGTTTTGGAGGCTGAGG - Intronic
922375932 1:224965802-224965824 CCATGGTGCCTGGCAGGTAGTGG + Intronic
922705861 1:227789693-227789715 GCATGGGGTCTGAAGGGCAGTGG - Intergenic
922763315 1:228145426-228145448 CCATGAATTCAGGAAGGCAGAGG + Intronic
923239248 1:232064394-232064416 GCATGGTGTCTGCCAGCCAGTGG + Intergenic
1063320668 10:5049895-5049917 CCATGGAGTCAGGAGAGCAGAGG - Intronic
1063326232 10:5105878-5105900 CCATGGAGTCAGGAGAGCAGAGG - Intronic
1063336204 10:5217005-5217027 CCATGGAGTCAGGAGAGCAGAGG - Intronic
1064230807 10:13528530-13528552 CCATGGTGCGGGGAAGGCGGCGG + Intronic
1067841672 10:49685662-49685684 CCATGGAGGCCAGAAGGCAGTGG - Intronic
1070430594 10:76333903-76333925 GCATGGTGTGTGGGAGGCTGTGG + Intronic
1070785196 10:79158607-79158629 CCAGGATGCCTGGAGGGCAGTGG - Intronic
1071095704 10:81971771-81971793 CCATGGTGGCTAGAATGCACAGG + Intronic
1071124445 10:82318057-82318079 CCTTTGTGTCTGGTGGGCAGGGG + Intronic
1071133789 10:82429450-82429472 CCATGGAGTCCAGAAGGCAATGG - Intronic
1071600678 10:86957409-86957431 ACCTGGGGTCTGGAAGGCAGAGG - Exonic
1072262137 10:93688748-93688770 CCAGGGTGGATGGAATGCAGTGG - Intronic
1072424782 10:95320786-95320808 CAATGGTGAGTGGAAGGCGGGGG - Intronic
1072810039 10:98454440-98454462 CCTTGGTGTTTGGAAGGAGGTGG + Intergenic
1073062766 10:100742185-100742207 AAAGGGTTTCTGGAAGGCAGCGG + Intronic
1074864871 10:117539081-117539103 CAATGCTGTCTGGGAGGCAGTGG - Intergenic
1075428134 10:122357927-122357949 CCATCATCTCTGGATGGCAGTGG - Intergenic
1075647250 10:124104643-124104665 CCATGCAGTCTGGACGTCAGTGG + Intergenic
1075899983 10:126033786-126033808 CCATGGAGTCCAGAAGGAAGGGG + Intronic
1075983099 10:126758309-126758331 CCATGGAGACTGGGAGACAGAGG - Intergenic
1076057466 10:127387217-127387239 CCAGTGTGGCTGGAATGCAGAGG - Intronic
1076387105 10:130065158-130065180 CCCTGCTTCCTGGAAGGCAGGGG + Intergenic
1077355895 11:2116877-2116899 CCATGGGGGCTGGAAGACAATGG - Intergenic
1077706018 11:4486259-4486281 CTATGGGGTGTGGAAGCCAGTGG + Intergenic
1078004616 11:7523213-7523235 CAAAGGTGTGTGGAAGGGAGGGG - Intronic
1078589112 11:12622507-12622529 CTATGGAATCTGGGAGGCAGTGG + Intergenic
1080851504 11:36074224-36074246 TCTTGGAGGCTGGAAGGCAGAGG + Intronic
1081577415 11:44327827-44327849 CCATGGTGTCTGGCCTGAAGAGG - Intergenic
1081619051 11:44608018-44608040 CCATCTTTTCTGGAAGGCAGGGG + Intronic
1081694132 11:45097881-45097903 CCAAGGAATTTGGAAGGCAGGGG + Intronic
1082195047 11:49293669-49293691 CCATGGTCATTGGAAGGCTGAGG + Intergenic
1082247256 11:49938853-49938875 CTATGGTGTCAGAAGGGCAGCGG + Intergenic
1083161163 11:60855003-60855025 CTGTGGTCTCTGGAAGGGAGTGG - Intronic
1083285238 11:61654559-61654581 CCATGATGTCGGGGAGGGAGGGG - Intergenic
1083498520 11:63080960-63080982 CCCTGGTTTCTGGAAGGAGGAGG + Exonic
1084281763 11:68100837-68100859 CCACTGGGTCTGGAGGGCAGGGG - Intronic
1084609290 11:70191908-70191930 CCATGGAGACAGGAGGGCAGAGG - Intergenic
1084979658 11:72822360-72822382 CGCCGGTGTCTGGAAGGGAGGGG + Intronic
1085009913 11:73131618-73131640 CGCTTGAGTCTGGAAGGCAGAGG + Intronic
1088253686 11:107883497-107883519 CGATGGAATCTGGGAGGCAGAGG - Intronic
1088813233 11:113405405-113405427 CCCTGGTGTCTGGAGCTCAGAGG + Intergenic
1089836423 11:121374447-121374469 CCTTTGTGTCAGGTAGGCAGAGG + Intergenic
1090044740 11:123321225-123321247 CCTTGGTTTCTGGAATGCACTGG - Intergenic
1090241320 11:125183999-125184021 CCATGGTGGCTAGAACACAGTGG - Intronic
1091068945 11:132544807-132544829 GCATGGTGTGTGCAATGCAGAGG - Intronic
1091820613 12:3472847-3472869 CTAAAGTGTCTGGCAGGCAGGGG + Intronic
1091937096 12:4442840-4442862 ACATGGCCTCTGGAGGGCAGGGG - Intronic
1092254053 12:6916666-6916688 CCCAGGTGTCCTGAAGGCAGTGG + Exonic
1092922510 12:13245298-13245320 CCATTGGGTCTTGAAGGCACAGG - Intergenic
1095561732 12:43574051-43574073 CCATGGAGTTTGGAGAGCAGAGG + Intergenic
1096308690 12:50501618-50501640 CCATGGAGCCCAGAAGGCAGTGG + Intergenic
1096809935 12:54162796-54162818 CCATGGGGTGGGGAGGGCAGGGG - Intergenic
1096980468 12:55725754-55725776 CCAGGGTGCCTGGAGGGAAGGGG - Intronic
1097676122 12:62603661-62603683 CCATGGTGTCGGGGAGGCACGGG - Exonic
1097777473 12:63665387-63665409 CACTGGTGCCTGGGAGGCAGAGG + Intronic
1098224720 12:68309817-68309839 CCTTGGTTACTGGTAGGCAGAGG - Intronic
1098380450 12:69863973-69863995 CCATGGAGGCTAGAAGGCAGTGG - Intronic
1098992719 12:77082237-77082259 GCATGTTCTCTGGGAGGCAGAGG + Intergenic
1100615383 12:96227559-96227581 CCATGCTGTCAGGAAGGCCCCGG + Intronic
1100772502 12:97938984-97939006 CCATGGTGTGTATAAGGAAGAGG - Intergenic
1101718538 12:107331860-107331882 CCATGGTGGATGGAGGGCAGGGG + Intronic
1102311096 12:111844886-111844908 GCAAGGTGGCTGGAATGCAGTGG + Intronic
1102477508 12:113198258-113198280 CCAGTGTGACTGGAAGGGAGTGG + Intronic
1102950429 12:117027380-117027402 ACCGGGTGCCTGGAAGGCAGTGG - Exonic
1103174003 12:118845803-118845825 GCATGGTTTCTGGAACACAGTGG + Intergenic
1103567945 12:121826514-121826536 CCATGGTGTGAGGAAGGGAAGGG + Intronic
1103632438 12:122272963-122272985 CCATGGTGTGTGGAATGGGGAGG + Exonic
1103654423 12:122458916-122458938 GCATGGTGGCTGGAAGGCCCAGG + Intergenic
1103883630 12:124185283-124185305 CCATGGCTTCTGGAATGCACTGG + Intronic
1105002418 12:132699369-132699391 CCATGCTGGCTGGAGTGCAGTGG - Intronic
1105917425 13:24929449-24929471 CCATGGAGGCCAGAAGGCAGTGG - Intergenic
1106204252 13:27574875-27574897 CCATGGAGACTAGAAGGCAGTGG + Intronic
1106977804 13:35242702-35242724 CCATGCATGCTGGAAGGCAGTGG + Intronic
1107554734 13:41507827-41507849 CTCTGGGGTCTGGAAGACAGTGG + Intergenic
1108485820 13:50923495-50923517 CTATGGTGGCTGGAAGTGAGTGG + Intronic
1109003318 13:56835243-56835265 CTCTGGGGTCTGGAAGACAGTGG + Intergenic
1110156415 13:72322333-72322355 CCATGCTGTCTGGAAGACGGAGG - Intergenic
1110615337 13:77535337-77535359 CCATAGTACCTGGAAGGCAGGGG - Intergenic
1111946972 13:94676401-94676423 GCATTGTCTCTGGAAGCCAGAGG - Intergenic
1112871400 13:103975210-103975232 CCATCCAGGCTGGAAGGCAGTGG - Intergenic
1113684121 13:112268762-112268784 CCATGGAACCTGGAAGACAGTGG - Intergenic
1113765489 13:112878312-112878334 CCCAGGTGCGTGGAAGGCAGAGG - Intronic
1114508681 14:23238107-23238129 CCATCGCCTCTGGAAAGCAGGGG + Intronic
1114531641 14:23400201-23400223 CCACTTTGTCTGGATGGCAGAGG + Intronic
1114531957 14:23402102-23402124 CCATGTTGTTTGGGAGGCAGTGG - Intronic
1118729368 14:68655718-68655740 CCATGGCTGCTGGAAGCCAGAGG - Intronic
1121107058 14:91287766-91287788 CCATGGGGTCTTGGAGGCGGAGG - Intronic
1121566654 14:94914975-94914997 CCAGGGTGTTTGAAAGCCAGAGG - Intergenic
1121701726 14:95959805-95959827 CCATGGGATGTGGAAGGCAGGGG - Intergenic
1121725179 14:96142106-96142128 GCATGGTGTCTGACACGCAGCGG + Intergenic
1121910773 14:97790463-97790485 CCAGGGTGTTTGGACGGGAGGGG - Intergenic
1122041877 14:98993598-98993620 GCATAGTGTTTGGAAGGGAGAGG - Intergenic
1122076206 14:99236588-99236610 CCCTGATGTCTAGAGGGCAGGGG + Intronic
1122506417 14:102234595-102234617 CCATAGTGAATGGAAGGGAGGGG - Intronic
1122576526 14:102746581-102746603 CGACGGTGTCTGGGAAGCAGGGG + Intergenic
1123123098 14:105927104-105927126 CCAGGGTGTCAGGAAGGCAGGGG + Intronic
1123123628 14:105929459-105929481 CCAGGGTGTCAGGAAGGCAGGGG + Intronic
1123405736 15:20018522-20018544 CCAGGGTGTTAGGAAGGCAGGGG + Intergenic
1123406269 15:20020959-20020981 CCAGGGTGTCAGGAAGGCAGGGG + Intergenic
1123515066 15:21025170-21025192 CCAGGGTGTTAGGAAGGCAGGGG + Intergenic
1123515599 15:21027607-21027629 CCAGGGTGTCAGGAAGGCAGGGG + Intergenic
1124245205 15:28064118-28064140 CCATGGAGGCCAGAAGGCAGTGG - Intronic
1124530435 15:30500751-30500773 CATTTGTGTCTGGAGGGCAGGGG - Intergenic
1124768224 15:32506937-32506959 CATTTGTGTCTGGAGGGCAGGGG + Intergenic
1125696786 15:41644617-41644639 CCAGGCTGGCTGGAGGGCAGTGG - Intronic
1127359412 15:58231853-58231875 CCCTGCTGGCTGGAAGGCACTGG - Intronic
1128158675 15:65408881-65408903 CCAGGCTGGCTGGAATGCAGTGG + Intronic
1128536113 15:68491850-68491872 CCAGGGGGGCTGGAAGGAAGAGG + Intergenic
1128980387 15:72181143-72181165 CCTTTGAGTCTGGAGGGCAGAGG + Intronic
1128987330 15:72230979-72231001 CCAGGGCGTCTGGGATGCAGTGG - Exonic
1129481698 15:75831617-75831639 CCACAGTGACTGGAAGACAGAGG - Intergenic
1129689718 15:77706289-77706311 CCAGGGGGTCTGGCAGGCCGTGG - Intronic
1132342812 15:101088774-101088796 CCATGGTGGCTAGAAGCCGGGGG + Intergenic
1132615830 16:840729-840751 CCATGGCCCCCGGAAGGCAGGGG + Intergenic
1132849432 16:2018162-2018184 CCCTGGTGTCTGGGACCCAGGGG + Intronic
1132858065 16:2056281-2056303 CCCTGGTTTCTGGGAGGCTGGGG + Intronic
1132991269 16:2796182-2796204 TAACGGTGTCTGGGAGGCAGGGG - Intergenic
1133864160 16:9626266-9626288 CCTGGCTGGCTGGAAGGCAGTGG - Intergenic
1134012198 16:10862959-10862981 CCATGGCGGCTGGAAGACTGTGG - Intergenic
1134194994 16:12152968-12152990 CCATGATGGATGGATGGCAGGGG - Intronic
1135555943 16:23436766-23436788 CCATGTTTCCTGGAAGGCTGAGG - Intronic
1136042213 16:27588968-27588990 CCCTTGAGTCTGGAAGGCGGAGG - Intronic
1136078556 16:27836178-27836200 CCATGGAGGCTAGAAGGAAGTGG - Intronic
1136297123 16:29309925-29309947 CCCTGGTGGCTGGGAAGCAGAGG - Intergenic
1136537797 16:30910558-30910580 CCCTGGTGGCTGGGAGGGAGGGG + Intergenic
1137619698 16:49868237-49868259 CCACGGTGCCAGGGAGGCAGGGG + Intergenic
1138622785 16:58225091-58225113 CCATGCAGGCTGGAATGCAGTGG - Intergenic
1139373044 16:66480216-66480238 CCAGGGTGTCTGGTAGCCTGAGG + Intronic
1139627648 16:68203547-68203569 CGCTGGAGCCTGGAAGGCAGAGG + Intronic
1140350478 16:74257630-74257652 CCATTGTGGCTGGAGGGGAGGGG + Intergenic
1140692705 16:77499519-77499541 GCATGCAGTCTGGGAGGCAGGGG + Intergenic
1141171272 16:81693258-81693280 CCATGCATTCTGGGAGGCAGTGG + Intronic
1141873742 16:86807172-86807194 ACAAGGAGGCTGGAAGGCAGCGG + Intergenic
1141923985 16:87154965-87154987 TCATGGTGGCTGGAGTGCAGTGG - Intronic
1142058674 16:88016028-88016050 CCCTGGTGGCTGGCAAGCAGAGG - Intronic
1142743620 17:1944039-1944061 CCAAGCTGTCTGGGAGGCTGAGG - Intronic
1142809496 17:2388649-2388671 CCAGGGAGTCTGGAGGGGAGTGG - Intronic
1144949830 17:18988204-18988226 CCTGGGTGGCTGGAGGGCAGGGG - Intronic
1146206231 17:30907515-30907537 TGTTTGTGTCTGGAAGGCAGTGG + Intronic
1146629089 17:34457388-34457410 CCATGGTGTGAGCAAGGCAGGGG + Intergenic
1146841907 17:36162129-36162151 CCTTCGTGGCTGGAAGGCTGAGG - Intergenic
1146854218 17:36250089-36250111 CCTTCGTGGCTGGAAGGCTGAGG - Intronic
1146870121 17:36373981-36374003 CCTTCGTGGCTGGAAGGCTGAGG - Intronic
1146877478 17:36425062-36425084 CCTTCGTGGCTGGAAGGCTGAGG - Intronic
1147073002 17:37974605-37974627 CCTTCGTGGCTGGAAGGCTGAGG - Intergenic
1147084524 17:38054143-38054165 CCTTCGTGGCTGGAAGGCTGAGG - Intronic
1147100471 17:38178109-38178131 CCTTCGTGGCTGGAAGGCTGAGG - Intergenic
1147120938 17:38334703-38334725 CCTGGCTGTGTGGAAGGCAGCGG + Exonic
1147321462 17:39648714-39648736 GCATGGGGGCTCGAAGGCAGGGG - Intronic
1147569527 17:41560080-41560102 CCTGGGTGTCCAGAAGGCAGGGG + Intergenic
1147625938 17:41899983-41900005 CCCTTGAGTCTGGGAGGCAGAGG + Intronic
1147649227 17:42052523-42052545 CCATGCTGGCTGGGAGGCAAAGG + Intronic
1148760572 17:49997777-49997799 CCTGGGTATCTGGAAGGCAGTGG - Intergenic
1150083412 17:62261155-62261177 CCTTCGTGGCTGGAAGGCTGAGG - Intergenic
1150128687 17:62654447-62654469 GCATGGTGCCTGGCATGCAGCGG - Intronic
1150496184 17:65609638-65609660 CAGTGGTGTCAGGAAAGCAGTGG - Intronic
1150877272 17:68984055-68984077 TCATGGTGTCAGGAAGGCTGAGG - Exonic
1150885725 17:69083211-69083233 TCATGGTGTCTGGAAGGCTTAGG - Exonic
1151732516 17:75919894-75919916 CCATGGCGCAAGGAAGGCAGAGG + Intronic
1151736716 17:75946950-75946972 CGCTGGAGTCTGGGAGGCAGAGG - Intronic
1151920389 17:77150383-77150405 GCAGGGTATCTGGAAGGGAGAGG - Intronic
1153436283 18:5071421-5071443 ACAAGGGGTCTGGATGGCAGGGG - Intergenic
1153475786 18:5497138-5497160 CCAGGGTAGCTGGAATGCAGGGG + Intronic
1153612553 18:6900959-6900981 CCATGAAGGCTGGAAGGAAGTGG + Intronic
1153725505 18:7950362-7950384 CCAGGTTGGCTGGAATGCAGGGG - Intronic
1153931571 18:9884065-9884087 CCCTGCTGTTTGGAAGGGAGTGG - Intergenic
1153996354 18:10445333-10445355 ACATGGTGTCTGAAATACAGTGG + Intergenic
1154083401 18:11279657-11279679 CCTTGGTTCCTGGAAGGCATTGG - Intergenic
1156447816 18:37250054-37250076 CCAGTGTGTCTGGTAAGCAGTGG + Intronic
1156454959 18:37287646-37287668 CCATGGTGGCTGGAACAAAGTGG - Intronic
1156472128 18:37383980-37384002 GCAGGGTGTCTGGAAGGAGGAGG - Intronic
1157326513 18:46672784-46672806 CCAAGGTCTCAGGAAGCCAGGGG + Intronic
1157344097 18:46807772-46807794 CCATAGAGTCAGAAAGGCAGAGG + Intergenic
1157674122 18:49555852-49555874 CCAGTGTGGCAGGAAGGCAGAGG + Intergenic
1157708336 18:49828214-49828236 CCATGGAGGCTAGGAGGCAGTGG + Intronic
1158205700 18:54990350-54990372 ACAAGCTGTCTGCAAGGCAGTGG - Intergenic
1160850447 19:1189028-1189050 CCATGCAGGCTGGAGGGCAGTGG + Intronic
1160926064 19:1546446-1546468 CGATGGAGTCGGGGAGGCAGTGG + Intergenic
1161056604 19:2193801-2193823 CCAGGGTGTGTTGGAGGCAGGGG + Intronic
1161223935 19:3133600-3133622 CCCTGGTGTCTGGGAGGAGGTGG + Intergenic
1161451785 19:4350364-4350386 CCATGGAGTGTTGCAGGCAGAGG + Intronic
1162439202 19:10682351-10682373 CCACTGTGGCTGGCAGGCAGAGG + Intronic
1162467491 19:10850986-10851008 TCATGGTTTTTGGAAGGCAATGG - Intronic
1162943547 19:14028597-14028619 CCATGGGGGCTGGAAGTCTGAGG + Intronic
1163120335 19:15213692-15213714 CCACCGTGGCTGGAGGGCAGTGG - Intergenic
1163292544 19:16388871-16388893 CAATGGAGGCTGGAAGGCAGTGG + Intronic
1163627828 19:18400802-18400824 CGCTTGAGTCTGGAAGGCAGAGG + Intergenic
1164120507 19:22261623-22261645 TCCTGGTGCCTGGAAGGCGGGGG + Intergenic
1164621171 19:29696867-29696889 GCAGGGTGTCTGGGTGGCAGAGG + Intergenic
1164621331 19:29697555-29697577 GCAGGGTGTCTGGGTGGCAGAGG - Intergenic
1164623316 19:29710618-29710640 CCATGGAGTATGAGAGGCAGTGG + Intronic
1165108306 19:33487215-33487237 CCTGGGTGAGTGGAAGGCAGGGG + Intronic
1165640668 19:37383317-37383339 CCCTTGTACCTGGAAGGCAGAGG - Intronic
1166225025 19:41389729-41389751 CCAGGGTGGCTGAAGGGCAGAGG - Intronic
1166239318 19:41478987-41479009 CCATGGGGTCTGGGGGGCTGAGG - Intergenic
1166248827 19:41551571-41551593 CCATGGGGTCTGAGAGGCTGAGG + Intronic
1167341352 19:48918380-48918402 CCTGGTTGTCTGGGAGGCAGAGG + Intronic
1167402150 19:49280031-49280053 CTATGGTGTCTTCCAGGCAGGGG - Intergenic
1168029147 19:53665889-53665911 CACTTGAGTCTGGAAGGCAGAGG - Intergenic
1168177825 19:54636906-54636928 CCATGGAGTCTGGAATGCATGGG + Exonic
1168483806 19:56743595-56743617 CCATGGTGGTTGGAAGGTAGAGG - Intergenic
1168525931 19:57088830-57088852 CCGTGGGGTCTGGAGGGCAGAGG - Intergenic
927128524 2:20036234-20036256 CCATGGTGGCTGGCACACAGAGG - Intronic
927505365 2:23609914-23609936 CCATGGGCTCTGGAAAGAAGTGG - Intronic
927844375 2:26463845-26463867 CCAGGCTTTCTGGAATGCAGCGG + Intronic
928216145 2:29362979-29363001 CCATTGTGTGTGGAAGGAAGGGG + Intronic
928898796 2:36295718-36295740 CCATAGTCCCAGGAAGGCAGAGG + Intergenic
929177636 2:38997634-38997656 CCATGGAGGCCAGAAGGCAGTGG + Intronic
929907095 2:46055700-46055722 CCCTGTTGGCTGGAATGCAGTGG + Intronic
929965077 2:46528603-46528625 CCATGGAGCCTCCAAGGCAGAGG - Intronic
930612268 2:53555639-53555661 CCCGGGTGTCTGCAGGGCAGAGG + Intronic
931734960 2:65185782-65185804 CCAGGCTGGCTGGAATGCAGTGG + Intergenic
932665953 2:73699005-73699027 TTCTGGTGTCTGGAAGGCATTGG - Intergenic
932734833 2:74247299-74247321 CCATTGCCTCTGGAAGGCAGAGG + Exonic
933511216 2:83244520-83244542 CCAGGCTGGCTGGAATGCAGTGG + Intergenic
933544682 2:83695326-83695348 CCTGGGTGTCGGGAGGGCAGGGG - Intergenic
934527363 2:95059983-95060005 CCATGGTGTCTGGGAGGCAGTGG - Intergenic
935606223 2:104974527-104974549 CCATGCTGTGAGGAAGGCAGGGG - Intergenic
935782215 2:106518125-106518147 GCATGGTGTCTTGTATGCAGTGG + Intergenic
936049490 2:109212336-109212358 CCATGTTGTCGGGAAAGTAGGGG + Intronic
937066438 2:119021229-119021251 TGATGGTGTGTGGAAGGCAGGGG + Intergenic
937935324 2:127239307-127239329 TCCTGGGGTCTGGAGGGCAGTGG - Intergenic
942192264 2:173481993-173482015 ACATGGTGTCTGGGAGCCAAAGG + Intergenic
942996448 2:182266749-182266771 TCTTGCTGTCTGGAATGCAGCGG + Intronic
943065443 2:183081327-183081349 CGCTGGAGCCTGGAAGGCAGAGG - Intronic
943434169 2:187843170-187843192 TCATGGAGTCTGGAATGGAGGGG + Intergenic
945147983 2:206758837-206758859 CCATGTTCTCTGGAAGGGATTGG + Intronic
945270652 2:207936020-207936042 CCAGGCTGGCTGGAATGCAGTGG + Intronic
945435122 2:209809599-209809621 GCAGGGTGTCTGGTAGGGAGAGG - Intronic
946048767 2:216843288-216843310 CCAGGGGGCCTGGAAGGAAGGGG + Intergenic
946203957 2:218089938-218089960 CCACAGAGCCTGGAAGGCAGAGG - Exonic
947096044 2:226568059-226568081 CCAAGGTTTATGGAAGTCAGTGG + Intergenic
947248593 2:228077292-228077314 CAGTGGGGTCTGGAAGACAGTGG - Intronic
947765589 2:232635067-232635089 CCAGGGTGTCAGGGAGGCAGAGG - Intronic
948269696 2:236664861-236664883 CCCATGGGTCTGGAAGGCAGAGG + Intergenic
948516089 2:238504711-238504733 CCATGCTGTGTGGGAAGCAGGGG + Intergenic
1168790204 20:571138-571160 CCCTGCTGTCTGGAAGGCTAAGG - Intergenic
1168833883 20:863713-863735 CTATTGAGCCTGGAAGGCAGAGG + Intergenic
1168846403 20:947490-947512 TCTGGGTGTCTGGAGGGCAGGGG - Intergenic
1170605113 20:17869922-17869944 ACCTGGTTTCTGGAAGGCAGGGG - Intergenic
1172041046 20:32046157-32046179 CCATTGTGGCTGGAACACAGAGG - Intergenic
1172479723 20:35263948-35263970 CTATGGTGTGTGGCAGGGAGAGG + Exonic
1172992983 20:39049748-39049770 ACATGGATTCTGGGAGGCAGAGG - Intergenic
1173379839 20:42530342-42530364 GCATGGTGCCTGGCATGCAGCGG - Intronic
1174195924 20:48772728-48772750 CCATCCTGGCTGGACGGCAGTGG - Intronic
1174262548 20:49307115-49307137 CCGTGGTGTCTGCAGCGCAGAGG - Intergenic
1174365948 20:50056448-50056470 TCATTCTGTCTGGAATGCAGTGG - Intergenic
1174752166 20:53122566-53122588 CCAAGGTGTTTGGAGGGAAGAGG + Intronic
1175256171 20:57648674-57648696 CCATGGAATCAGGCAGGCAGGGG + Exonic
1175892643 20:62322329-62322351 CCATGGTCCCTGGTCGGCAGTGG + Exonic
1176004683 20:62854341-62854363 CTCTGGCCTCTGGAAGGCAGTGG - Intronic
1176256111 20:64154118-64154140 CCATGGAGCCTGGAAGGCCTGGG - Intronic
1176923081 21:14712557-14712579 CCATGGAGGCCGGAAGGCACTGG + Intergenic
1177206570 21:18017430-18017452 CCAGAGTGGCTGGAAGGCAAAGG - Intronic
1177837200 21:26197698-26197720 CCCAGGTGTCTGGGAGGCTGAGG - Intergenic
1178393335 21:32217775-32217797 CCATGGAATCGGGAAGGCAAAGG + Intergenic
1179094755 21:38303472-38303494 ACATGGTGCCTGGCAGACAGTGG + Exonic
1179247900 21:39649392-39649414 CCAGGGAGGCTGGCAGGCAGAGG - Intronic
1179612050 21:42558826-42558848 CCAGGATGTCTCCAAGGCAGTGG + Intronic
1179715806 21:43287562-43287584 CCGTGGTGTCTGGAATACAGCGG - Intergenic
1180581942 22:16846090-16846112 GCCTGGTGTGTGGAGGGCAGGGG - Intergenic
1182302380 22:29344442-29344464 CCATCCTGTCTGGATGGCAGGGG - Intronic
1183705804 22:39474314-39474336 CCATGGGGTCCTGATGGCAGTGG + Intronic
1183776776 22:39971311-39971333 CAGGGGTGTGTGGAAGGCAGTGG + Exonic
1183933004 22:41246800-41246822 CCACGGTGTGCAGAAGGCAGAGG - Intronic
1184582359 22:45426227-45426249 CATTTGTGCCTGGAAGGCAGTGG - Intronic
1184676537 22:46046049-46046071 CAATGCTCTCTGGAAGGCTGGGG - Intergenic
1184825791 22:46949965-46949987 CCATGGGGCCTGGAGGCCAGTGG + Intronic
1184894343 22:47398414-47398436 CCATGGTGCCTTTAAGACAGAGG + Intergenic
1185047668 22:48537184-48537206 CCCGGGTGTCTCAAAGGCAGAGG - Intronic
949835273 3:8262194-8262216 CCATGAAGGCTGGAAGGCAGTGG - Intergenic
949959783 3:9302448-9302470 ACATGGTGTCTGCAAGGAAGGGG + Intronic
952486606 3:33818145-33818167 CCAGGGTGGATGGAGGGCAGTGG + Intronic
952569574 3:34698358-34698380 CTCTGGTGTCTGCAAGGGAGAGG + Intergenic
953028536 3:39160268-39160290 CCAGGGTGGCTGGAATACAGTGG + Intergenic
954095204 3:48320669-48320691 CCTTGGTGTGAGGGAGGCAGGGG + Intronic
954149995 3:48652544-48652566 CCATGGTGTCCTGGAGGAAGTGG + Exonic
954460950 3:50626615-50626637 CCGTGCTTTCTGGCAGGCAGTGG + Intronic
955028876 3:55197341-55197363 CCATGCTGCGTGGAAGCCAGGGG + Intergenic
955347687 3:58173243-58173265 CCCTGGGGTCAAGAAGGCAGGGG - Intergenic
955869019 3:63417456-63417478 CTGTGGGGTTTGGAAGGCAGTGG + Intronic
956644784 3:71444890-71444912 CCATGGGGACTGGAGGGTAGAGG + Intronic
956727096 3:72165018-72165040 CCAGGTTGTCGGGGAGGCAGTGG - Intergenic
957367625 3:79246883-79246905 CCATGGTGTTTGGCACTCAGTGG - Intronic
957429963 3:80091549-80091571 CCCTTGAGCCTGGAAGGCAGAGG - Intergenic
960964081 3:123092463-123092485 CCATGGTGGCTGCTGGGCAGAGG + Intronic
961267175 3:125653021-125653043 CCAAGGTGTAAGTAAGGCAGAGG + Intergenic
962364861 3:134772179-134772201 CCATGGTGCCTCCAAGGGAGAGG - Intronic
962531094 3:136280975-136280997 CCATGGAGGCCGGAAGGCAGTGG - Intronic
962925943 3:139993434-139993456 CCCTGGAGTCTGCAAGGAAGAGG + Intronic
963575380 3:147054469-147054491 CCATGGAGTCTATAAAGCAGTGG + Intergenic
963983044 3:151561781-151561803 CCAAAGTATGTGGAAGGCAGAGG + Intergenic
965666492 3:171099496-171099518 CCATGGTGTCTGGAATACAGTGG - Intronic
965912863 3:173802877-173802899 TCATGGAGACTGGAGGGCAGTGG + Intronic
966916643 3:184587936-184587958 GCAGGGTGTGTGGGAGGCAGTGG - Intronic
967230424 3:187332637-187332659 CCATTTTAACTGGAAGGCAGAGG - Intergenic
967789046 3:193527645-193527667 ACATGGCGGCAGGAAGGCAGGGG - Intronic
968309359 3:197670326-197670348 GCATGGTGTCTGGAACACGGAGG + Intergenic
968507737 4:979496-979518 CCAGGACGTCTGGAAGGAAGTGG + Intronic
968847087 4:3050027-3050049 CATTGGTGTGTGGGAGGCAGAGG - Intergenic
969376139 4:6764546-6764568 CCACAGTGTCTGGTAGACAGGGG + Intergenic
969595699 4:8148249-8148271 CCAGTGTGTCTGGAGGGGAGAGG + Intronic
970842504 4:20490963-20490985 GCATGGTTTCTGGAAGACAGTGG - Intronic
971317648 4:25580798-25580820 TCAAGTTGTCTGGAAGGAAGGGG - Intergenic
972109179 4:35533938-35533960 CCTTTGAGTCTGGTAGGCAGAGG + Intergenic
972365042 4:38366675-38366697 TCATGCTATTTGGAAGGCAGAGG - Intergenic
972382209 4:38529592-38529614 ACATGGTATCCTGAAGGCAGTGG + Intergenic
972506264 4:39723125-39723147 TCCTGGAGTCTGGAAGGCAGGGG - Intronic
972606993 4:40622796-40622818 CACTGGAGCCTGGAAGGCAGAGG + Intronic
972849582 4:43032477-43032499 CCAGAGTGTCTGGAAGTGAGGGG + Intergenic
972890773 4:43553756-43553778 CTCTGGGGTCTGGAAGACAGTGG - Intergenic
973819704 4:54652289-54652311 CACTGGAGTCTGGGAGGCAGAGG - Intergenic
974123473 4:57667259-57667281 GAATTGTTTCTGGAAGGCAGAGG - Intergenic
975052387 4:69882399-69882421 CCAGGGAGGCTGGAAGGAAGAGG - Intergenic
977142897 4:93397673-93397695 CCTTGGTGTCTGTGAGGCATTGG + Intronic
977253524 4:94715001-94715023 ACATGGTTTCTGGAAAGCTGAGG + Intergenic
978979268 4:114922046-114922068 TCCTGGTGACTGGAAGGCGGTGG - Intronic
980702733 4:136454301-136454323 GCCTGGTGTCTGGAGGACAGTGG - Intergenic
980775198 4:137427957-137427979 CCCTTGAGTCTGGGAGGCAGAGG + Intergenic
980878505 4:138686253-138686275 TCATGGAGCCTGGAAGGCACAGG + Intergenic
981251997 4:142614176-142614198 CCATGTTGGCTGGAGTGCAGTGG - Intronic
981322699 4:143411090-143411112 CCAATGTGGTTGGAAGGCAGAGG + Intronic
981335395 4:143563260-143563282 CTCTGGGATCTGGAAGGCAGTGG - Intergenic
981470595 4:145130175-145130197 GCATGGTGTCTGGCATGTAGTGG + Intronic
982528987 4:156514903-156514925 CTGTGGTGTCTGGGATGCAGTGG - Intergenic
982858926 4:160423531-160423553 CCATTGTGGTTGGAAGACAGTGG - Intergenic
983600530 4:169521753-169521775 CCATGGAGTTTAGAAGGAAGTGG - Intronic
983753875 4:171309937-171309959 CCATGGTGTCTGGAAGAATTTGG - Intergenic
984369563 4:178845214-178845236 CCATGGAGGCCAGAAGGCAGTGG + Intergenic
984654318 4:182300739-182300761 GCATGGTGGTTGGAAGGCTGAGG + Intronic
984856693 4:184201435-184201457 CCATGGTGTGTAGACCGCAGTGG + Intronic
985065488 4:186116635-186116657 CCAGGCTGGCTGGAGGGCAGCGG + Intronic
985796576 5:1966555-1966577 CCTTGGTGTCTGGAGGGCTCTGG + Intergenic
986201278 5:5581172-5581194 CCAGGGTGTCTGGAATGTAGTGG - Intergenic
986356737 5:6936063-6936085 AAATGGTGTTTTGAAGGCAGTGG + Intergenic
987027105 5:13938626-13938648 CCATGGTTTCTGGCATTCAGTGG + Intronic
987547186 5:19326890-19326912 ACATGGTGTTTGTAAGACAGAGG + Intergenic
988473846 5:31565481-31565503 CTCTGGGGTCTGGAAGACAGTGG + Intergenic
988641125 5:33041707-33041729 TCCAGGTGTCTGCAAGGCAGAGG - Intergenic
989152762 5:38316674-38316696 ACATGGGCTTTGGAAGGCAGTGG - Intronic
989448120 5:41554752-41554774 CCATGGTGTCTGGCAGAGAAGGG + Intergenic
990849110 5:60181452-60181474 CCTTGGTGTTTGGAAGACATAGG - Intronic
991402549 5:66268836-66268858 CCATGGAGGCCAGAAGGCAGTGG - Intergenic
992199547 5:74369920-74369942 CCATGGAGGCTGGAGTGCAGTGG - Intergenic
992296409 5:75331111-75331133 CCCTGGAGCCTGGGAGGCAGAGG - Intergenic
992483011 5:77169632-77169654 TCAGCATGTCTGGAAGGCAGTGG + Intergenic
992525577 5:77606761-77606783 CCATGTAGGCTGGAATGCAGTGG - Intronic
993823326 5:92648397-92648419 CCATGGAGGCTAGAAGGCAATGG + Intergenic
995105465 5:108372590-108372612 CCATGGAGACCAGAAGGCAGTGG + Intronic
996912326 5:128669906-128669928 CCATGGTGGCAGGAATGGAGTGG - Intronic
997764707 5:136489449-136489471 CCATGGAGACCAGAAGGCAGTGG - Intergenic
997791214 5:136764026-136764048 CCAGGCTCTCTTGAAGGCAGAGG + Intergenic
998382492 5:141735659-141735681 CCATCATGTCTGGGAGCCAGAGG - Intergenic
998390694 5:141785333-141785355 CCTTGGAATCTGGAATGCAGGGG + Intergenic
998561257 5:143173779-143173801 TCATGCTGTGTGGAAGGGAGAGG + Intronic
999278273 5:150346893-150346915 CCATGGTGTATGGAGGCCATGGG + Intergenic
1001282064 5:170393218-170393240 TGAGGGTGTCTGGAAAGCAGTGG - Intronic
1003073968 6:2967256-2967278 ACATGGTGTATGTAAGGAAGGGG - Intronic
1003441659 6:6148409-6148431 ATGTGGTGTCTAGAAGGCAGGGG - Intronic
1004427155 6:15514154-15514176 CCATGGCGACTGGATGGCTGTGG + Intronic
1004629691 6:17409408-17409430 TCATTGTGTCTGGAAGATAGAGG + Intronic
1005529799 6:26691529-26691551 CCTTGGTGTCTCTAAGGCATAGG + Intergenic
1005540997 6:26810118-26810140 CCTTGGTGTCTCTAAGGCATAGG - Intergenic
1006147095 6:31966177-31966199 CCCTTGAGCCTGGAAGGCAGAGG - Intronic
1006287372 6:33106970-33106992 TGATGGTGTCTGGAGGGCAAGGG - Intergenic
1007323139 6:41041367-41041389 ATATGATGTGTGGAAGGCAGAGG - Intronic
1007420221 6:41714777-41714799 CCTTGGGGTGTGGAGGGCAGAGG - Intronic
1007992214 6:46268844-46268866 CCATTATTTCTGGAAGGCAGGGG + Intronic
1008130265 6:47713172-47713194 CCATGGACTCTGGGTGGCAGAGG - Intronic
1008544473 6:52573566-52573588 CCATCCTGTTTCGAAGGCAGGGG - Intronic
1009910994 6:69926937-69926959 CCATGGAGACCAGAAGGCAGTGG + Intronic
1012763856 6:103338837-103338859 CCCTTGTATCTGGGAGGCAGAGG - Intergenic
1014048628 6:116925575-116925597 CCAGGTTGACTGGATGGCAGAGG - Exonic
1014293848 6:119593986-119594008 TTGTGGAGTCTGGAAGGCAGAGG + Intergenic
1015634248 6:135260536-135260558 CAATGGGGGCTGCAAGGCAGGGG - Intergenic
1015777086 6:136824806-136824828 CCCTGGGGTCTGTAAGCCAGAGG + Intronic
1016477331 6:144441620-144441642 CCCTGGGGTCTGGAGGACAGTGG + Intronic
1016519899 6:144935390-144935412 CAATGGGGTCCAGAAGGCAGTGG + Intergenic
1017286894 6:152686067-152686089 CCCGGGTGTCTAGAGGGCAGGGG - Intergenic
1017772578 6:157654341-157654363 CCTAGGTGTCTGGAAGGCAATGG + Intronic
1017823633 6:158065965-158065987 ACATGCAGGCTGGAAGGCAGAGG + Intronic
1017905992 6:158757845-158757867 CGATGCTGTGAGGAAGGCAGAGG + Intronic
1018218376 6:161552754-161552776 CCATGGTGTCTTTTAGGAAGGGG - Intronic
1018486596 6:164246706-164246728 CCAAGGTGTGAGGAAGCCAGAGG - Intergenic
1019006528 6:168802347-168802369 CCATGCTGTTTGGATGGCAGTGG - Intergenic
1019160219 6:170064399-170064421 CCCTGGTGTCCGGATGGGAGGGG + Intergenic
1019218097 6:170456438-170456460 GGATGGAGTCTGGAAAGCAGGGG - Intergenic
1019320501 7:413278-413300 CCAAGGGGTCTGGGAGGGAGGGG + Intergenic
1019875160 7:3803802-3803824 CAGTGGTGGCTGGAATGCAGTGG + Intronic
1020775672 7:12451058-12451080 TTATGGGGTCTGGAGGGCAGTGG - Intergenic
1021420378 7:20439971-20439993 CCCAGGTGTCTAGAGGGCAGGGG + Intergenic
1022703373 7:32781797-32781819 TTCTGGGGTCTGGAAGGCAGTGG + Intergenic
1022990548 7:35703032-35703054 CGCTGGAGTCCGGAAGGCAGAGG - Intergenic
1025229763 7:57194952-57194974 CCATGGTGGAAGGAAGTCAGGGG - Intergenic
1026065639 7:67070054-67070076 CCATGGAGGCCAGAAGGCAGTGG - Intronic
1026351929 7:69524682-69524704 CCATGGAGCCCAGAAGGCAGTGG - Intergenic
1026711236 7:72741806-72741828 CCATGGAGGCCAGAAGGCAGTGG + Intronic
1028046010 7:86119733-86119755 CAATGGAGTCCTGAAGGCAGTGG + Intergenic
1028497145 7:91474718-91474740 CCATGGAGGCCAGAAGGCAGTGG + Intergenic
1029102726 7:98147064-98147086 CCGTGGAGGCTAGAAGGCAGTGG - Intronic
1029187723 7:98751770-98751792 CCAATGTGTCTGGAGGGAAGTGG + Intergenic
1029439900 7:100581881-100581903 TCCTGGTATCAGGAAGGCAGTGG + Exonic
1029525359 7:101090582-101090604 AGATGGGGTCTGGAATGCAGTGG - Exonic
1029788263 7:102815513-102815535 CTCTGGTGTTTGGGAGGCAGGGG - Intronic
1030028292 7:105346383-105346405 GCATGGTGACTGGAACACAGAGG + Intronic
1030416333 7:109248298-109248320 CCATGCTGTCTGGTGGGCAAAGG - Intergenic
1030425826 7:109376041-109376063 CCATGGTGTCTGGAATTCCAAGG + Intergenic
1033111633 7:138583668-138583690 CCAGTGTGTGTGGAAGGCAGTGG + Intronic
1034208165 7:149336776-149336798 CTTTGGAGGCTGGAAGGCAGTGG + Intergenic
1034346054 7:150385848-150385870 CCATGGAGACTGGGAGGCAGGGG + Intronic
1034964515 7:155382989-155383011 CCCTGGTGCCTGGAGGGCTGTGG + Intronic
1035026685 7:155831047-155831069 CCTTGGTGCCCGGAACGCAGAGG - Intergenic
1035108220 7:156459575-156459597 CCATGGAGTCTGGAGGACACGGG + Intergenic
1035308318 7:157947872-157947894 CCATGGAGGCCTGAAGGCAGTGG + Intronic
1035314481 7:157989663-157989685 CCATGGTCTGGGGGAGGCAGCGG + Intronic
1035562754 8:618569-618591 CCAAGGTCTCTGAAAGACAGTGG - Intronic
1036260197 8:7233474-7233496 CCATGCAGGCTGGAATGCAGTGG - Intergenic
1036312234 8:7692030-7692052 CCATGCAGGCTGGAATGCAGTGG - Intergenic
1037577178 8:20218439-20218461 CCAAGATGTTTAGAAGGCAGAGG - Intronic
1038849928 8:31265831-31265853 GCACAGTGTCTGGAAAGCAGAGG - Intergenic
1039254011 8:35698909-35698931 CTATTGTGACTGGAAGGTAGGGG + Intronic
1039294420 8:36133876-36133898 CCCTGGAGTCTGCAATGCAGAGG + Intergenic
1039337396 8:36607122-36607144 CCAGGGTGTCAGGAATGCTGAGG - Intergenic
1039497072 8:37988340-37988362 ACATGGTCACTGGAAGGCTGTGG - Intergenic
1039906730 8:41791832-41791854 CCATGGTGTCTGGAAGGCAGCGG - Intronic
1041188591 8:55328957-55328979 CCAGGGTGTCTGCGAGGTAGTGG - Intronic
1041894168 8:62904655-62904677 CCAGGGTGTCTGAAATACAGTGG - Intronic
1044784342 8:95778663-95778685 CCATGGTGTGAGGAGGGCAGTGG - Intergenic
1045466168 8:102471961-102471983 CCATGGATTCTGGAAGGAAGTGG + Intergenic
1045672536 8:104571901-104571923 CCCTGGTGTCAGAAAGGCTGGGG + Intronic
1048022000 8:130547832-130547854 CCATGGTGTTTGAAAGCCAAGGG - Intergenic
1048125461 8:131630126-131630148 CCATGGTGTTTGGAAGGTCTAGG - Intergenic
1048308304 8:133298547-133298569 CCATGCTGTCCCCAAGGCAGGGG + Intronic
1049463558 8:142740973-142740995 GCGTGGGGTATGGAAGGCAGAGG + Exonic
1051966585 9:22835891-22835913 AGATGCTGTCTGGAAGTCAGGGG + Intergenic
1052223687 9:26058316-26058338 CCATGGTGTCAGGATGGATGTGG - Intergenic
1052270679 9:26625356-26625378 CCATGGTCCCTGGGTGGCAGTGG - Intergenic
1052651984 9:31316280-31316302 CCAAGGTGGTGGGAAGGCAGTGG - Intergenic
1056099267 9:83285174-83285196 CAAGTGTGTGTGGAAGGCAGAGG - Intronic
1056319628 9:85424142-85424164 CCATGCTCTCTTGAAGGCACTGG - Intergenic
1056418651 9:86402360-86402382 CCAGGCTGTCTGGAATGCAGTGG + Intergenic
1057429387 9:94980150-94980172 CAATGGTCTCTGGGAGGCACAGG - Intronic
1057805573 9:98217345-98217367 CTGTGCTGTGTGGAAGGCAGTGG + Intronic
1058391006 9:104495829-104495851 CCAAGGCGTCTGGAAGTCATGGG - Intergenic
1059380353 9:113918881-113918903 CCATGGTGTCTGGCACGTTGTGG + Intronic
1059900545 9:118920880-118920902 AGATGCTATCTGGAAGGCAGGGG + Intergenic
1059913431 9:119072291-119072313 CCCTTGTACCTGGAAGGCAGAGG + Intergenic
1060656871 9:125378030-125378052 GCATGGAGCCTGGCAGGCAGAGG + Intergenic
1060750707 9:126166541-126166563 ACGTGGAGTCAGGAAGGCAGAGG + Intergenic
1060949548 9:127592852-127592874 CCATGCTGGCTGGAGTGCAGTGG + Intergenic
1061484106 9:130911728-130911750 CAACTGTGTCCGGAAGGCAGGGG + Intronic
1062003005 9:134226205-134226227 CCAGGGGGGCTGGGAGGCAGGGG + Intergenic
1062210338 9:135360209-135360231 CCATGGTGTCAGGTAGGGAGTGG + Intergenic
1186839404 X:13470005-13470027 CCCTTGAGTCTGGGAGGCAGAGG + Intergenic
1190990560 X:55545390-55545412 CCATGGAGGCCAGAAGGCAGTGG - Intergenic
1191213980 X:57916772-57916794 CCCTGGAGTCAGGAGGGCAGAGG - Intergenic
1192465702 X:71354158-71354180 CCATGGAGGCTGGACTGCAGTGG + Intergenic
1192504093 X:71670427-71670449 GCATGGGGTATGGTAGGCAGAGG - Intergenic
1192538635 X:71949820-71949842 GCTTGGTATGTGGAAGGCAGAGG - Intergenic
1193403686 X:81076914-81076936 GCATGGGGTGTGGAGGGCAGGGG + Intergenic
1193561169 X:83017481-83017503 CCATGGAGGCTGGAAAGCAGTGG + Intergenic
1194749713 X:97670822-97670844 CAATGGGATCTGGAAGGCACTGG - Intergenic
1195265555 X:103176157-103176179 CCATGCTTTCTGGGAGGGAGGGG - Intergenic
1195351384 X:103999878-103999900 CCCTGGTGCCAGGAAGGCTGGGG - Intergenic
1195659116 X:107361008-107361030 CCCTGGGGTCTGGATGGCAAGGG - Intergenic
1195982126 X:110590561-110590583 CATTTGTGTCTGGTAGGCAGGGG + Intergenic
1196556214 X:117087572-117087594 TCATTGTCTCTGGATGGCAGAGG - Intergenic
1197186279 X:123590755-123590777 ACCTGGTGTCTTGAATGCAGAGG + Intergenic
1198106074 X:133462540-133462562 CCATGAAGACTGGAAGACAGTGG - Intergenic
1198639827 X:138744312-138744334 CCCTGATGTATGGAAGGCATAGG + Intronic
1199780053 X:151050239-151050261 ATATGGTGTCTGGAATTCAGGGG - Intergenic
1202344696 Y:23909115-23909137 CCCTTGAGCCTGGAAGGCAGAGG - Intergenic
1202526072 Y:25760968-25760990 CCCTTGAGCCTGGAAGGCAGAGG + Intergenic