ID: 1039906736

View in Genome Browser
Species Human (GRCh38)
Location 8:41791838-41791860
Sequence GGCCCCCCATGGTGTCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039906736_1039906740 -4 Left 1039906736 8:41791838-41791860 CCTTCCAGACACCATGGGGGGCC No data
Right 1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG No data
1039906736_1039906748 30 Left 1039906736 8:41791838-41791860 CCTTCCAGACACCATGGGGGGCC No data
Right 1039906748 8:41791891-41791913 AGGCGTTCCTATAGGAGAGAAGG No data
1039906736_1039906739 -8 Left 1039906736 8:41791838-41791860 CCTTCCAGACACCATGGGGGGCC No data
Right 1039906739 8:41791853-41791875 GGGGGGCCCAGAGCTTTCTCAGG No data
1039906736_1039906744 22 Left 1039906736 8:41791838-41791860 CCTTCCAGACACCATGGGGGGCC No data
Right 1039906744 8:41791883-41791905 ACCCTTCCAGGCGTTCCTATAGG No data
1039906736_1039906743 10 Left 1039906736 8:41791838-41791860 CCTTCCAGACACCATGGGGGGCC No data
Right 1039906743 8:41791871-41791893 TCAGGAAGGAAAACCCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039906736 Original CRISPR GGCCCCCCATGGTGTCTGGA AGG (reversed) Intronic