ID: 1039906736

View in Genome Browser
Species Human (GRCh38)
Location 8:41791838-41791860
Sequence GGCCCCCCATGGTGTCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039906736_1039906743 10 Left 1039906736 8:41791838-41791860 CCTTCCAGACACCATGGGGGGCC 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1039906743 8:41791871-41791893 TCAGGAAGGAAAACCCTTCCAGG No data
1039906736_1039906740 -4 Left 1039906736 8:41791838-41791860 CCTTCCAGACACCATGGGGGGCC 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG No data
1039906736_1039906744 22 Left 1039906736 8:41791838-41791860 CCTTCCAGACACCATGGGGGGCC 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1039906744 8:41791883-41791905 ACCCTTCCAGGCGTTCCTATAGG No data
1039906736_1039906739 -8 Left 1039906736 8:41791838-41791860 CCTTCCAGACACCATGGGGGGCC 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1039906739 8:41791853-41791875 GGGGGGCCCAGAGCTTTCTCAGG No data
1039906736_1039906748 30 Left 1039906736 8:41791838-41791860 CCTTCCAGACACCATGGGGGGCC 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1039906748 8:41791891-41791913 AGGCGTTCCTATAGGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039906736 Original CRISPR GGCCCCCCATGGTGTCTGGA AGG (reversed) Intronic
901754886 1:11435443-11435465 GGGCCCCCATGGTGGCCGGAGGG + Intergenic
902272710 1:15316213-15316235 GGCATCCCATGGTGTCTGACGGG - Intronic
902512437 1:16973726-16973748 GGCCCCACATGCTGGTTGGAGGG + Intergenic
903384170 1:22916027-22916049 GGCCCCCCATGGGGACAGCAGGG + Intergenic
905937073 1:41833228-41833250 GGTCCACCAGGGTCTCTGGATGG + Intronic
906294533 1:44641337-44641359 GGCCCTCCCTGGTGACTGAAGGG + Intronic
907216765 1:52870602-52870624 GGCCTCCCAAGGTGCCGGGATGG - Intronic
913266374 1:117049088-117049110 TGCCTCCCCTGGTGTCTGAAGGG - Intergenic
915553433 1:156647988-156648010 GGCCTCTCGTGGGGTCTGGATGG - Exonic
915925076 1:160011113-160011135 GGGCCGCCATGCTGGCTGGAGGG + Intergenic
919297969 1:195724830-195724852 GGCCACGCATGGTGGCTGGCTGG + Intergenic
921779689 1:219147651-219147673 GCCACCCCAGTGTGTCTGGAAGG - Intergenic
923329331 1:232908257-232908279 AGCCCCCCATTGTGCTTGGAGGG - Intergenic
923788127 1:237087709-237087731 TGCCCCTCTTGGTGTCTGGGTGG + Intronic
1066479863 10:35785459-35785481 GACCCACCATGGTCTCTGCATGG + Intergenic
1066758804 10:38736370-38736392 TGTCCCCCATGGTGTCTCCAGGG - Intergenic
1069620201 10:69832776-69832798 TGCTCCGCATGGTGGCTGGATGG - Intronic
1070858356 10:79628213-79628235 GGCCCCTCTTGGTGCCTGGCAGG + Intergenic
1071246853 10:83774109-83774131 GGTCCCACATGCTGTCTTGAAGG - Intergenic
1071565120 10:86667727-86667749 GGGCCCCCAGAGGGTCTGGAGGG + Intergenic
1072548166 10:96456627-96456649 GGCCCTCCTTTATGTCTGGAGGG - Intronic
1075428138 10:122357933-122357955 GGCACCCCATCATCTCTGGATGG - Intergenic
1076540939 10:131214293-131214315 GGACCCCCAGGGAGTCTGGATGG + Intronic
1077683522 11:4269409-4269431 GCCACCCCAGTGTGTCTGGAAGG - Intergenic
1077686518 11:4297354-4297376 GCCACCCCAGTGTGTCTGGAAGG + Intergenic
1077691672 11:4348542-4348564 GCCACCCCAGTGTGTCTGGAAGG + Intergenic
1079665202 11:23096022-23096044 GGCCTCCCATGGGTTCTGGGTGG + Intergenic
1081354137 11:42092243-42092265 TACCCCTCATGGTTTCTGGAGGG - Intergenic
1081742457 11:45450021-45450043 GACCCCACAGAGTGTCTGGAGGG - Intergenic
1084522763 11:69674752-69674774 GGCTCCCCAGGGGCTCTGGAGGG + Intronic
1084777456 11:71387013-71387035 TGCCCACCCTGGTGTCTGGAAGG + Intergenic
1084945573 11:72636633-72636655 GCCCCACCCAGGTGTCTGGATGG - Intronic
1085016376 11:73176868-73176890 CAGCCCACATGGTGTCTGGAAGG + Intergenic
1085640549 11:78189979-78190001 GGCACCACCTGGTGTCGGGAGGG + Intronic
1092229534 12:6768947-6768969 TGCCTCCCATGGTGTATGCATGG - Intronic
1096214344 12:49791349-49791371 GGTCCTCCCTGCTGTCTGGATGG - Exonic
1096530309 12:52238481-52238503 TGCCCACCATGCAGTCTGGAGGG + Intronic
1100287492 12:93181417-93181439 TCCCCCCTCTGGTGTCTGGAAGG - Intergenic
1102626058 12:114236314-114236336 AGCCCCTCATGGAGTCTTGAAGG - Intergenic
1103654421 12:122458910-122458932 GGCCTAGCATGGTGGCTGGAAGG + Intergenic
1104905251 12:132210005-132210027 GGCCTCTCTTGGGGTCTGGATGG + Intronic
1118708528 14:68501529-68501551 AGCCCCCCATGGTGTGTAAAAGG - Intronic
1122248626 14:100422581-100422603 GACCCCTCATGGTGACTTGACGG + Intronic
1122959878 14:105089540-105089562 GGTCCCCCAGTGTGTCTGCACGG - Intergenic
1123056802 14:105574685-105574707 AGCCCCCCAAGGAGGCTGGAGGG + Intergenic
1123081408 14:105697100-105697122 AGCCCCCCAAGGAGGCTGGAGGG - Intergenic
1202863938 14_GL000225v1_random:103766-103788 GGCCCTCCATGGTGACAGGTGGG + Intergenic
1125605014 15:40935221-40935243 GGCCCCCCATCTGCTCTGGAGGG + Intronic
1126026257 15:44448610-44448632 GGACCCCCATGGTGGCGGTATGG - Intronic
1126167035 15:45662536-45662558 CGCCCCCCAGGGTGGCTGGATGG - Intronic
1126787776 15:52192015-52192037 GGCTCCTCATGGTGTGGGGAAGG + Intergenic
1128934692 15:71735258-71735280 TGCCCCCCATGCAGACTGGAAGG - Intronic
1130049183 15:80468810-80468832 CTCCCCTCATGGGGTCTGGAAGG + Intronic
1132355341 15:101167734-101167756 GGCCCCCCCTGGGGTCTGGTAGG - Intergenic
1132663270 16:1070890-1070912 GGCAACCGATGGTGGCTGGATGG - Intergenic
1133773622 16:8882173-8882195 GGCCCCACATGGTGGGTGGGTGG - Intergenic
1135640846 16:24118620-24118642 GTCCCCTCGTGCTGTCTGGAAGG + Intronic
1136247910 16:28985769-28985791 GCCCCGCCATGGGGTGTGGAGGG - Intronic
1136412575 16:30085902-30085924 GCCTCCCCATGGGCTCTGGAGGG - Exonic
1139471201 16:67179060-67179082 GGCCCTCCAGGGTGGATGGAAGG - Intronic
1139659366 16:68410319-68410341 GGCCACCCCTGGTCTGTGGATGG - Intronic
1142177004 16:88650078-88650100 CGCCCTCCCTGTTGTCTGGAGGG - Intronic
1142825216 17:2506540-2506562 GGCCTCCCAAGGTGCCGGGATGG + Intronic
1145019023 17:19415743-19415765 GGTTCCGCATGGTGTCTGGCAGG - Exonic
1146009119 17:29180048-29180070 CGCCCCCCAGGTTGGCTGGAAGG + Intronic
1146169458 17:30621596-30621618 GGGCCCCCATGGGGTCAGGATGG + Intergenic
1146170104 17:30625853-30625875 GGGCCCCCATGGGGTCAGGATGG - Intergenic
1146343557 17:32041882-32041904 GGGCCCCCATGGGGTCAGGACGG - Intronic
1146903362 17:36602152-36602174 GGTCCACCAGGGTGTCTGCATGG + Exonic
1149646591 17:58245730-58245752 GGAGCCCCATGGTGTTGGGAGGG + Intronic
1150697371 17:67417456-67417478 AGCCCACCATGGTGTCAGCAAGG + Intronic
1150806166 17:68320752-68320774 GGCCCACCTGGGTGGCTGGAAGG + Intronic
1150885727 17:69083217-69083239 TGGCCATCATGGTGTCTGGAAGG - Exonic
1152564372 17:81093549-81093571 GAGCCCCCATGGTCTCTGGGAGG - Intronic
1152635356 17:81428583-81428605 GGTCCCCCAGGGTGGGTGGAGGG - Intronic
1153779890 18:8485207-8485229 GGGCCCCCCGGGTGGCTGGAAGG - Intergenic
1154028049 18:10725808-10725830 GGCCCTCCAGGGTGGATGGAAGG + Intronic
1160542072 18:79629304-79629326 GGCCCCTCTTGGTCTCTGGAAGG - Intergenic
1160767154 19:813726-813748 GGGCCCCCAGGGCGGCTGGAGGG - Exonic
1162022697 19:7874831-7874853 GGCCGCCCAGGGTCTCTGGGGGG + Intergenic
1162938360 19:13993415-13993437 TGCCCCCCAAGGTTTCTGGATGG - Intronic
1164120501 19:22261617-22261639 GGCCCATCCTGGTGCCTGGAAGG + Intergenic
1164720050 19:30425320-30425342 GGCCCCAGGGGGTGTCTGGAAGG + Intronic
1165095110 19:33405951-33405973 GGGCCTCCTGGGTGTCTGGAGGG + Intronic
1166274772 19:41745399-41745421 GGCCCCACAGGGAGGCTGGAAGG - Intronic
1167917892 19:52756958-52756980 GGCTCCCCAGGGAGGCTGGAAGG + Intergenic
1167925004 19:52814144-52814166 GGCTCCCCAGGGAGGCTGGAAGG + Intronic
925305135 2:2842813-2842835 TGCACCCCAGGGTGCCTGGAAGG + Intergenic
928593682 2:32841118-32841140 GTCCCAGCATGGTGTGTGGATGG - Intergenic
932364803 2:71143425-71143447 GGCCCAGCATGGTGGCTGGCTGG - Intronic
933835074 2:86239541-86239563 GGCACCCCATGGGGTTTGGAAGG - Intronic
935130642 2:100258546-100258568 GACACCCCATGGGGTCTGGGGGG + Intergenic
935636095 2:105250908-105250930 GGCCTCCCAAGGTGCCGGGATGG + Intergenic
937296451 2:120812524-120812546 GGTCCCCCATGGTGGCAGCACGG - Intronic
938297342 2:130186297-130186319 GTCCCCACAGGCTGTCTGGATGG - Intronic
944433782 2:199665170-199665192 GGCATACCATGGAGTCTGGAGGG + Intergenic
944902355 2:204228592-204228614 GGCCCTCCCTCGTCTCTGGAAGG - Intergenic
945057940 2:205884508-205884530 GGCCCACCAGGGTGTGGGGATGG - Intergenic
948609651 2:239158731-239158753 GCCCTCTCCTGGTGTCTGGAGGG - Intronic
1169275558 20:4231618-4231640 GGCCCAGCATGGTGCCTAGAAGG - Intronic
1170833149 20:19860696-19860718 CACTCCCCATGGAGTCTGGATGG + Intergenic
1173712718 20:45174910-45174932 TGGCCCTCATGGTGTCAGGAAGG - Exonic
1174145130 20:48448028-48448050 GTCTCCCCATCCTGTCTGGATGG + Intergenic
1174539434 20:51277399-51277421 GGGCCCCCACGGAGTCTGCATGG - Intergenic
1175062750 20:56258668-56258690 TGACCCCCATGATTTCTGGATGG + Intergenic
1179492114 21:41747314-41747336 GGCCCCACATGGTGAATTGAGGG - Intronic
1181182300 22:21077001-21077023 GTCCCCGCAGGCTGTCTGGATGG + Intergenic
1182496465 22:30711825-30711847 AGCCCACCATGGTGTCTGCCTGG + Intronic
1183374401 22:37454593-37454615 GGGCCCCAATGGTGTCTTCAGGG - Intergenic
1183978554 22:41526891-41526913 GGCACCCCCTGGTGGCTGGGTGG + Exonic
949384868 3:3489774-3489796 GCCCCCCAATGGTGTGTGCAAGG - Intergenic
964064357 3:152561386-152561408 GGCCCTCCATGTAGTCTGGGAGG + Intergenic
967177381 3:186873513-186873535 GGCCTCCCAAGGTGCCGGGATGG + Intergenic
968231739 3:197008573-197008595 AGCCCAGCATGGTGTCTGGATGG + Intronic
968883552 4:3314867-3314889 GCCCCCCGCTGGTGTCAGGACGG + Exonic
971267288 4:25106622-25106644 GGCTCCCCATTGTATCTGCATGG + Intergenic
973397125 4:49604739-49604761 GGCCTCCCAAGGTGTTGGGATGG - Intergenic
983274774 4:165603656-165603678 GGCTCCACATGGTGTCAAGATGG - Intergenic
983644196 4:169973066-169973088 GTTCCCCCATGGTGTCTAGATGG - Intergenic
992174848 5:74139807-74139829 GGTGCCCCATGGTGTCTTGGGGG - Intergenic
992529503 5:77640986-77641008 GGCTCCACACGCTGTCTGGAGGG + Intergenic
997691094 5:135828010-135828032 GGCCCTCCTTGGGTTCTGGATGG - Intergenic
998545334 5:143022895-143022917 GTCCACCCATGGGGGCTGGAAGG + Intronic
998986522 5:147763960-147763982 ATTCCCCCATGGTGTCTGGCTGG - Intronic
999357753 5:150953211-150953233 GCCACCCCATGGTGCCTGGCTGG + Intergenic
1001663825 5:173416179-173416201 GGCCCACCATGGGGAATGGAGGG - Intergenic
1001705435 5:173737975-173737997 GCCCCTCCATGGGCTCTGGAGGG + Intergenic
1002049900 5:176564813-176564835 GCCCACCCATAGTCTCTGGATGG + Intronic
1007503361 6:42315654-42315676 GGCCCCACCTGGTCTCTTGAAGG - Intronic
1018203819 6:161417992-161418014 GGCCCCCCATGGAGTCAGCCAGG - Intronic
1025129909 7:56369795-56369817 GGCCCCAAATGGTCTCTGGTCGG - Intergenic
1025821760 7:64968811-64968833 GGCCTCCCAAGGTGCCAGGATGG - Intergenic
1026812016 7:73475636-73475658 GGCCCGGCATGGTGGCTGGCCGG + Intronic
1026960435 7:74404277-74404299 GCTCCCCCTTGGTGTCTGCATGG - Exonic
1028276672 7:88865680-88865702 GGCCCTCCATGGTGTGTCAAGGG - Intronic
1034743083 7:153496342-153496364 GGCCCCTCACAGTGCCTGGAAGG - Intergenic
1034911102 7:154999579-154999601 GGCAAGCCTTGGTGTCTGGAAGG + Intronic
1035658805 8:1331440-1331462 TGCCCGGCATGGTGCCTGGAAGG - Intergenic
1039172299 8:34761424-34761446 AGCCCCCCTTGTTCTCTGGAAGG - Intergenic
1039906736 8:41791838-41791860 GGCCCCCCATGGTGTCTGGAAGG - Intronic
1045401342 8:101821932-101821954 GCCCCCACATGCTGGCTGGATGG + Intronic
1046660011 8:116938652-116938674 GGCCCCCCAAGGCGTCGGGTGGG - Intronic
1047773128 8:128046596-128046618 AGCCCCCCATCGCATCTGGAGGG + Intergenic
1048195348 8:132327839-132327861 AGCCCCCCATGGTGTGGGAAGGG + Intronic
1049437503 8:142594563-142594585 GGTCACCGATGGTGTGTGGAGGG + Intergenic
1049607252 8:143535523-143535545 TGACCCCCACGGTGTCTGGGGGG + Intronic
1056624986 9:88245684-88245706 GGCCTCCCAAGGTGCCGGGATGG - Intergenic
1057831832 9:98413120-98413142 GGTCCCCCATGGTCTTTGTAGGG - Intronic
1061255081 9:129450547-129450569 GGCCCCCTTTGGTATTTGGAGGG - Intergenic
1061705798 9:132452160-132452182 GGCTCCCCTTGCTGTCTGCAGGG + Intronic
1061912038 9:133730074-133730096 GACCACGCAGGGTGTCTGGATGG + Exonic
1062181287 9:135192550-135192572 GGCCTCCCCTGTAGTCTGGAGGG - Intergenic
1203740381 Un_GL000216v2:172250-172272 GGCCCTCCATGGTGACAGGTGGG - Intergenic
1190042241 X:47080735-47080757 GGCCCCTCTGGGTGTCTGCAGGG - Exonic
1190690199 X:52907531-52907553 GGCCCCCTATGCTGTTGGGAGGG + Exonic
1190695784 X:52948261-52948283 GGCCCCCTATGCTGTTGGGAGGG - Exonic
1192260935 X:69505512-69505534 GGCCCCCCATGGGGGCCGCATGG - Exonic
1195659122 X:107361014-107361036 GCCCTCCCCTGGGGTCTGGATGG - Intergenic
1196556218 X:117087578-117087600 GGCCCCTCATTGTCTCTGGATGG - Intergenic
1196820483 X:119696626-119696648 GGCCCAGCATGGTGTCTGGCAGG + Intergenic