ID: 1039906737

View in Genome Browser
Species Human (GRCh38)
Location 8:41791842-41791864
Sequence TCTGGGCCCCCCATGGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 304}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039906737_1039906748 26 Left 1039906737 8:41791842-41791864 CCAGACACCATGGGGGGCCCAGA 0: 1
1: 0
2: 2
3: 20
4: 304
Right 1039906748 8:41791891-41791913 AGGCGTTCCTATAGGAGAGAAGG No data
1039906737_1039906744 18 Left 1039906737 8:41791842-41791864 CCAGACACCATGGGGGGCCCAGA 0: 1
1: 0
2: 2
3: 20
4: 304
Right 1039906744 8:41791883-41791905 ACCCTTCCAGGCGTTCCTATAGG No data
1039906737_1039906743 6 Left 1039906737 8:41791842-41791864 CCAGACACCATGGGGGGCCCAGA 0: 1
1: 0
2: 2
3: 20
4: 304
Right 1039906743 8:41791871-41791893 TCAGGAAGGAAAACCCTTCCAGG No data
1039906737_1039906749 27 Left 1039906737 8:41791842-41791864 CCAGACACCATGGGGGGCCCAGA 0: 1
1: 0
2: 2
3: 20
4: 304
Right 1039906749 8:41791892-41791914 GGCGTTCCTATAGGAGAGAAGGG No data
1039906737_1039906740 -8 Left 1039906737 8:41791842-41791864 CCAGACACCATGGGGGGCCCAGA 0: 1
1: 0
2: 2
3: 20
4: 304
Right 1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039906737 Original CRISPR TCTGGGCCCCCCATGGTGTC TGG (reversed) Intronic
900489276 1:2938810-2938832 TCTGGGGCCCCCACTGTGTGGGG + Intergenic
900526424 1:3131067-3131089 TCTGGCCACGCCATGGTGTGTGG + Intronic
900530070 1:3148737-3148759 TGTGGTCCCCCCATGGTCCCAGG - Intronic
900587286 1:3439494-3439516 GCTGCGCCCCCCATGCTGTGTGG + Intergenic
900605584 1:3522265-3522287 CCTGGGCCCTCCATGGGGTGAGG + Intronic
901318660 1:8325501-8325523 TCTGGGCCCGCACTGGTGTGAGG + Intronic
901873742 1:12154023-12154045 TCTGGGCCTCCCAAAGTGTTAGG - Intergenic
902038838 1:13477585-13477607 TCTTGGCCTCCCAAGGTGTTGGG - Intronic
905054331 1:35079859-35079881 CCTGGGCCTCCCAAAGTGTCGGG - Intronic
905680398 1:39866719-39866741 TCTTGGCCTCCCAAGGTGTTGGG - Intronic
906523067 1:46478681-46478703 TCTGGGCCTCCCATGATGCTGGG + Intergenic
908598429 1:65712242-65712264 CCTGGGCCCCCCAAAGTGTTTGG + Intergenic
908609106 1:65836190-65836212 TCTCGGCCTCCCATGGTGCTGGG + Intronic
912478730 1:109961301-109961323 TCGGGGCACCCCATGGTGAGAGG + Intergenic
913165331 1:116179612-116179634 TCTGGGTCACCCCTGGTGACTGG - Intergenic
914760563 1:150595150-150595172 TCTGAGCCTCCCAAGGTGCCAGG - Intergenic
915441708 1:155949626-155949648 TCTTGGCCTCCCAGAGTGTCGGG - Intronic
916318265 1:163474275-163474297 TCTTGGCCTCCCAAGGTGTTGGG + Intergenic
918066331 1:181104707-181104729 TCTCGGCCTCCCAGGGTGTCTGG - Intergenic
918885640 1:190190147-190190169 TCTGCGCCCTCCCTGGTGCCAGG - Intronic
919589555 1:199483590-199483612 TCTGGGCCCCACATGAAGTTTGG - Intergenic
919838312 1:201591764-201591786 TCTGTGCCCCCCAAGAGGTCTGG + Intergenic
921859608 1:220027730-220027752 CCTTGGCCTCCCATAGTGTCGGG - Intronic
923296335 1:232598149-232598171 TCTTGGCCTCCCAAAGTGTCAGG - Intergenic
924125236 1:240843514-240843536 CCTTGGCCTCCCAAGGTGTCAGG + Intronic
1065048207 10:21763179-21763201 TCTTGGCCTCCCAAAGTGTCAGG + Intronic
1065855003 10:29822993-29823015 TCTGTGCCTGCCATGGTGTTGGG + Intergenic
1069495093 10:68896708-68896730 CCTCGGCCCCCCAAGGTGTTGGG + Intergenic
1069838973 10:71327466-71327488 TCTGGGCCCACCATCCTGGCAGG + Intronic
1070017002 10:72543422-72543444 TCTGGGCCTCCCAAAGTGCCAGG - Intronic
1071875981 10:89843721-89843743 TCTTGGCCTCCCAAGGTGTTGGG + Intergenic
1072745989 10:97939515-97939537 TCTTGGCACCCCATGGTGCAAGG + Intronic
1073060161 10:100729264-100729286 TTTGGCGCCCCCATGATGTCGGG - Intergenic
1073307536 10:102515076-102515098 TCTGCACCCCCCGTGGGGTCTGG + Intronic
1074822270 10:117189433-117189455 TCTGGGCCTCCCAAAGTGTTGGG - Intergenic
1075130770 10:119737077-119737099 TCTGGGCCCCCCAAAGTGCTGGG + Intronic
1075629903 10:123994652-123994674 CCGGGGTCCCCCTTGGTGTCAGG + Intergenic
1076756963 10:132577563-132577585 CCTGAGCCCCCCATGGGGTCAGG + Intronic
1077320933 11:1941699-1941721 CCTTGGCCCCCCAAAGTGTCGGG + Intergenic
1077325707 11:1963095-1963117 TCTGGGGCGCCCATGGTGGGAGG + Intronic
1077422421 11:2459223-2459245 TCTGGGCGCCCCGTGGCGCCCGG + Intronic
1078595754 11:12685078-12685100 TCTGGGCCACTCCTGGTGACTGG + Intronic
1078754809 11:14199350-14199372 TCTGGGTGACTCATGGTGTCTGG - Intronic
1079487268 11:20948301-20948323 TCTTGGCCTCCCAAGGTGTTGGG + Intronic
1079665200 11:23096018-23096040 TCAGGGCCTCCCATGGGTTCTGG + Intergenic
1080667692 11:34350213-34350235 TCCGAGTCCCCCATGGTGTCCGG - Intronic
1081742459 11:45450025-45450047 TCTGGACCCCACAGAGTGTCTGG - Intergenic
1081937388 11:46914618-46914640 TCTGGGCCCCAGACTGTGTCTGG - Intronic
1082778918 11:57271032-57271054 CCTGGGTCCCCCATGCTGTAAGG - Intergenic
1083998742 11:66284731-66284753 ACGGGGCCCCCCATGCTGTCGGG + Exonic
1084196597 11:67526191-67526213 CCTTGGCCTCCCATGGTGTTGGG - Intergenic
1084704750 11:70809725-70809747 TCTCTGCTCCCCATGGTTTCAGG - Intronic
1085394656 11:76201202-76201224 TCTGGGCCCACCAGGGCCTCTGG - Intronic
1087216876 11:95504199-95504221 TCTGAGCCCCACATGCTCTCTGG - Intergenic
1087601175 11:100317989-100318011 TCTGGGCCTCCCAAAGTGTTGGG - Intronic
1202808687 11_KI270721v1_random:18274-18296 TCTGGGGCGCCCATGGTGGGAGG + Intergenic
1091732911 12:2894261-2894283 TCTCGGCCTCCCATGGTGCTGGG - Intronic
1092259815 12:6946747-6946769 ACTGGGACCCCGATGGTGCCCGG - Intronic
1092810248 12:12266396-12266418 CCTTGGCACCCCATGCTGTCGGG - Intronic
1093107660 12:15108980-15109002 TCTGGGCTTCCCATTGTTTCTGG - Exonic
1093243365 12:16705380-16705402 TCTTGCCCTGCCATGGTGTCTGG - Intergenic
1093918054 12:24828000-24828022 TCTTGGCCTCCCATAGTGTTGGG + Intronic
1093957132 12:25233298-25233320 TCTCGGCCTCCCAAGGTGTTGGG - Intronic
1094324738 12:29224966-29224988 TCTTGGCCTCCCAAGGTGTTAGG - Intronic
1094593172 12:31840193-31840215 TCTCGGCCTCCCAAAGTGTCAGG + Intergenic
1095251967 12:39989494-39989516 TCAGTGCCCCCAATGGTGCCTGG + Intronic
1096878694 12:54649767-54649789 TCTGGGTCCAACACGGTGTCTGG - Intergenic
1100466359 12:94849244-94849266 TCTGGGCCCCCCAGAGTGGAGGG - Intergenic
1101156279 12:101930554-101930576 TCTGGGCCTCCCAAAGTGTTAGG + Intronic
1102220544 12:111191574-111191596 CCTTGGCCCCCCAAAGTGTCGGG + Intronic
1102288125 12:111676126-111676148 TCTTGGCCTCCCAAGGTGTTGGG + Intronic
1102321468 12:111939202-111939224 TCTCGGCCTCCCATGGTGCTAGG - Intronic
1103795851 12:123502640-123502662 CCTGGGCCCCATATGGTGCCTGG + Intronic
1106162241 13:27212098-27212120 TGAGGGCCCCCCTTGGAGTCTGG + Intergenic
1109739388 13:66532252-66532274 TCTTGGCCTCCCAAAGTGTCCGG + Intronic
1111121062 13:83850032-83850054 TCTGGGCCTCCCAAAGTGTTGGG - Intergenic
1111641177 13:90972528-90972550 TCTTGGCCTCCCAAGGTGTTGGG - Intergenic
1112470231 13:99681834-99681856 TCTCGGCCCCCCACAGTGCCAGG + Intronic
1112600046 13:100846372-100846394 TCTGGGCCTCCCAAAGTGTTGGG + Intergenic
1113185175 13:107679608-107679630 TCAGCGCCCCCCACGGGGTCAGG + Intronic
1113481660 13:110626086-110626108 GCTGGGCCCCACAGGGTGTGGGG + Intronic
1113886265 13:113660166-113660188 TCTGGGCCCCCCTCATTGTCTGG - Intergenic
1113933531 13:113981291-113981313 TCCAGGCCACCCATGGTGCCCGG - Intronic
1118766585 14:68913776-68913798 ACTGTGCCCCGCCTGGTGTCTGG - Intronic
1121349189 14:93160248-93160270 TCTTGGCCTCCCATAGTGTTGGG - Intergenic
1121650833 14:95556664-95556686 TCTCGGCCTCCCAAAGTGTCAGG + Intergenic
1122123003 14:99564586-99564608 TCTGAGCCCCCCAGGGGGGCAGG + Intronic
1122427670 14:101621159-101621181 TCTGAGACCCCTGTGGTGTCTGG + Intergenic
1123121370 14:105918533-105918555 TCAGAGCCCCCCATGGGGTATGG - Intronic
1123834334 15:24172493-24172515 CCTCGGCCTCCCATGGTGCCGGG + Intergenic
1124527330 15:30469352-30469374 TCTGGGCCTCCCAAAGTGCCAGG - Intergenic
1124771323 15:32538331-32538353 TCTGGGCCTCCCAAAGTGCCAGG + Intergenic
1126635021 15:50771638-50771660 TCTGGGCCTCCCAAAGTGTTGGG - Intergenic
1126670533 15:51111512-51111534 TCTGGGTGCCCCATGATGGCAGG - Intergenic
1126674905 15:51152612-51152634 ACAGGGCCCCCCAGGGTGGCAGG - Intergenic
1127794475 15:62426335-62426357 TCTCTGCCTCCCAAGGTGTCTGG - Intronic
1128249351 15:66153667-66153689 TCTGGGCGCACCTGGGTGTCAGG - Intronic
1128327300 15:66732610-66732632 TCTTGGCCTCCCATGGTGCTGGG + Intronic
1129262460 15:74376282-74376304 GCTGGGCCACCCATGGTGATGGG - Intergenic
1132152761 15:99474314-99474336 TCTGGGCGTCCCAGGGTGCCAGG - Intergenic
1132539708 16:503056-503078 TCTGGGCCCTCCATGAGCTCGGG - Exonic
1132589982 16:722348-722370 GCTGGGGCCCGCGTGGTGTCTGG + Exonic
1133598166 16:7312913-7312935 TCTGGGGGCCCCAGGGTGCCTGG + Intronic
1133836631 16:9373428-9373450 TGTGGGGCCCCCATGGTGGGGGG + Intergenic
1134123689 16:11601808-11601830 CCTAGGCCTCCCATGTTGTCGGG + Intronic
1135407730 16:22210043-22210065 TCTGGGCCTCCCAAAGTGTTAGG + Intronic
1136568525 16:31083678-31083700 TCTGGGCCTGCCCTGGTGCCTGG + Exonic
1137395926 16:48116139-48116161 TCTGTGCCCAGCATGGTGCCAGG - Intronic
1137565946 16:49532541-49532563 TCTGGGTCCCCCGTGGGGCCCGG - Intronic
1137662522 16:50221034-50221056 TCTGGGCCTCCCAAAGTGTTGGG - Intronic
1139405640 16:66715480-66715502 TCTGGGCCTCCCAAAGTGTTGGG - Intergenic
1139576488 16:67845663-67845685 CCTGGACCCTCCCTGGTGTCTGG + Intronic
1141582146 16:85007063-85007085 TCTGGGCCCCATATGGAGTCTGG + Intronic
1142378643 16:89719966-89719988 CCTGGGCCTCCCAAAGTGTCAGG + Intronic
1142753627 17:2002830-2002852 TCTGGGCCCCTCCTGGTAGCCGG - Intronic
1143539139 17:7559082-7559104 ACTGGGCCCCCCATGTTGCCTGG - Exonic
1143622261 17:8087478-8087500 TGTGGCCCCTCCACGGTGTCTGG - Exonic
1144087879 17:11827073-11827095 TCTTGGCCTCCCAAGGTGTTGGG + Intronic
1144635731 17:16907743-16907765 TCTGGGCCACTCAAGATGTCAGG - Intergenic
1145301958 17:21647051-21647073 TCATGTCTCCCCATGGTGTCTGG - Intergenic
1145328305 17:21849805-21849827 TCATGTCTCCCCATGGTGTCTGG - Intergenic
1145348352 17:22056267-22056289 TCATGTCTCCCCATGGTGTCTGG + Intergenic
1145415233 17:22709096-22709118 TCATGTCTCCCCATGGTGTCTGG - Intergenic
1145695088 17:26781149-26781171 TCATGTCTCCCCATGGTGTCTGG - Intergenic
1147307444 17:39573774-39573796 TCCGGGGCCCCCATGGTGTCGGG - Intergenic
1147677887 17:42219974-42219996 TCTTGGCCCCCCTGGCTGTCAGG - Intronic
1147688158 17:42299597-42299619 TCTTGGCCCCCCTGGCTGTCAGG + Intronic
1147904440 17:43813706-43813728 TGTGGGGGCCCCGTGGTGTCAGG + Intronic
1148294821 17:46492213-46492235 CCTCGGCCTCCCATGGTGCCGGG + Intergenic
1148780176 17:50117098-50117120 TCTCGGCCTCCCAAGGTGTTGGG + Intronic
1148794139 17:50189136-50189158 TCAGGGCCCCCCAAGGTGAGGGG + Intronic
1150935012 17:69625878-69625900 TCTAGGCCACCCATGGTGAGGGG + Intergenic
1151434914 17:74089201-74089223 TCTGGGCCCTCCAGGGCTTCTGG + Intergenic
1152466240 17:80468256-80468278 TCTGACCCACCCATGGTGCCAGG - Exonic
1152581054 17:81165783-81165805 TCTGGGGCCGCCAGGGGGTCCGG + Intronic
1203192906 17_KI270729v1_random:205983-206005 TCATGTCTCCCCATGGTGTCTGG - Intergenic
1203202270 17_KI270730v1_random:5418-5440 TCATGTCTCCCCATGGTGTCTGG - Intergenic
1153677141 18:7465809-7465831 TCTTTGACCCCCATGGAGTCAGG + Intergenic
1155627336 18:27849790-27849812 GCTGGGCCCGCCACAGTGTCTGG + Intergenic
1157308183 18:46532073-46532095 TCTGGGCCCCTTATGGAGACAGG - Intronic
1159272112 18:66166529-66166551 TCTGGGCCTCCCAAAGTGCCGGG - Intergenic
1159500701 18:69265493-69265515 TCTGGGCCTCCAGTGGTGTAAGG - Intergenic
1160392070 18:78541349-78541371 TCTGTGATCCCCATGGAGTCTGG - Intergenic
1160542073 18:79629308-79629330 TCTGGGCCCCTCTTGGTCTCTGG - Intergenic
1160786327 19:901595-901617 TCTTGGGTCCCCATGGTGCCTGG - Intronic
1160855633 19:1215981-1216003 CCTCGGCCTCCCATAGTGTCGGG + Intronic
1160883499 19:1333741-1333763 TCTGGGCCTCCCAAAGTGCCGGG - Intergenic
1161174362 19:2831868-2831890 TCTGGGCCTCCCAAAGTGTTGGG + Intronic
1161500361 19:4611274-4611296 TCTGGGGCACCCCTGGGGTCTGG + Intergenic
1161798929 19:6404565-6404587 GGACGGCCCCCCATGGTGTCTGG - Intergenic
1162119136 19:8451291-8451313 CCTCGGCCCCCCAAGGTGTTGGG + Intronic
1162464460 19:10831685-10831707 CCTGGGTCCCCCAGGGTGGCTGG + Exonic
1162525515 19:11204027-11204049 TCTGGGACCCCCGTGATGACTGG - Intronic
1162550599 19:11356297-11356319 TCTGTGACCCCCATTGTGTGCGG + Intronic
1162595873 19:11628724-11628746 TCTAGGCCCCCCATAGTGCTAGG + Intergenic
1162726314 19:12691486-12691508 TCTGGGACCCCCATGGGCTGTGG - Intronic
1163044552 19:14630149-14630171 CCTGGGCTGCACATGGTGTCTGG - Exonic
1163633633 19:18428887-18428909 TCTGGGGCCCCGGGGGTGTCTGG + Intronic
1163904211 19:20137528-20137550 CCTGGGCCTCCCAAGGTGCCGGG + Intergenic
1164055329 19:21617288-21617310 TCTGGGTCCCCCAAAGTGTTGGG + Intergenic
1164780050 19:30884729-30884751 TCTGGGAACCACATGGTGTCAGG + Intergenic
1164989450 19:32673894-32673916 TCTTGGCCTCCCAAGGTGTTGGG - Intronic
1165002422 19:32776033-32776055 TCTGGGCCCTCGATGCTGCCTGG + Intronic
1165755965 19:38293135-38293157 TCTGGGCGCCCCATGAGGTCCGG + Intronic
1165900350 19:39166774-39166796 TCTGTGGCCCCCATGAGGTCAGG + Intronic
1166271378 19:41716382-41716404 TCTGGGCTCCCCTGGGTGACTGG + Intronic
1166377120 19:42333909-42333931 TCTGGGTCCCCCAGGGTGGAAGG + Intronic
1166564014 19:43752645-43752667 TCTCGGCCTCCCAAAGTGTCGGG - Intronic
1166964776 19:46522460-46522482 TCTTGGCCTCCCAAGGTGTTGGG - Intronic
1167671024 19:50853699-50853721 TCTCAGCCTCCCATGGTGTTGGG - Intergenic
1167698625 19:51029429-51029451 TCTGGGGGCCCCCTGGTGTGTGG - Exonic
1168404244 19:56102719-56102741 CCTGGGCCACCCCTGGTGTAAGG + Intronic
926052573 2:9754197-9754219 TCTGAGCCCCACCGGGTGTCCGG - Intergenic
926180294 2:10636949-10636971 TCTGGGCCTCCCAAGGTGCTAGG - Intronic
928014726 2:27645219-27645241 TCTTGGCCTCCCAAGGTGTTGGG + Intronic
928919668 2:36513570-36513592 GCTGGGCCACCCATCCTGTCGGG + Exonic
929181371 2:39043757-39043779 GGTGGGGCCCCCATGATGTCAGG - Intronic
929492358 2:42407906-42407928 TCTGGGCCCCCAAGAGTGTAGGG - Intronic
929515392 2:42602089-42602111 TCTTGGCCCCCCAAAGTGTTGGG + Intronic
930024358 2:47021255-47021277 TCTGGGCCCCCATAGGAGTCAGG - Intronic
930425533 2:51207729-51207751 TCTGGGCCTCCCAAAGTGTCTGG - Intergenic
930645795 2:53905448-53905470 CCTGGGCCTCCCATGGTATTGGG - Intronic
931234269 2:60400087-60400109 TCTTGGCCTCCCATAGTGTTAGG - Intergenic
932423409 2:71614272-71614294 TCTGGGAGCCCCAGGGTGCCAGG - Intronic
932754896 2:74400561-74400583 TCTTGGCCCCCCAAAGTGTTAGG - Intergenic
933903674 2:86868026-86868048 TCTCAGCCCCCCAAAGTGTCGGG - Intergenic
934504527 2:94880197-94880219 ACTGCGCCCCCCAGGGTGGCCGG - Intergenic
934516710 2:94992907-94992929 TCAGTGCCACCCAAGGTGTCAGG - Intergenic
934588492 2:95526593-95526615 TCTGGGCCCCGCATGGAGCGCGG - Intergenic
935627741 2:105185213-105185235 TGTGGGCCCCCTATGGTTCCTGG - Intergenic
938449557 2:131405009-131405031 CCTGGGCCACCGATGGTGTGTGG - Intergenic
940211039 2:151256943-151256965 TCTGTGCCCAGCATGGTGGCAGG - Intronic
941581476 2:167301797-167301819 CCTGGGCCCCCCAAAGTGTTGGG + Intergenic
943056735 2:182991305-182991327 TCTTGGCCTCCCATAGTGTTGGG - Intronic
947350047 2:229234187-229234209 TCAGGGCCCTCCATGGTTTTAGG - Intronic
948256498 2:236572553-236572575 CCTGGGAACCCCATTGTGTCTGG + Intronic
948653981 2:239465399-239465421 GCTGGGCCCTCCCTGGTGCCAGG + Intergenic
1168896730 20:1328842-1328864 TCGGGGGCCCTCATGATGTCTGG + Intronic
1169251099 20:4061856-4061878 TCTCGGCCTCCCAAAGTGTCGGG + Intergenic
1170698310 20:18680490-18680512 TCTGGGCCTCCCAATGTGTTGGG + Intronic
1171262407 20:23746246-23746268 TCTGGGCCTCACCCGGTGTCAGG - Intergenic
1171518539 20:25758451-25758473 TCATGTCTCCCCATGGTGTCTGG - Intergenic
1171558317 20:26097758-26097780 TCATGTCTCCCCATGGTGTCTGG + Intergenic
1171768554 20:29303191-29303213 TCTCGGCCTCCCAAAGTGTCGGG + Intergenic
1172389290 20:34555765-34555787 TCTGGGCCCCCCAAAGTGCTGGG + Intronic
1174699184 20:52590554-52590576 TCTGGTCCCACCTTGGTCTCAGG + Intergenic
1175789872 20:61734550-61734572 TCTGGGCCCCGCATGGTGCAGGG + Intronic
1175814842 20:61877985-61878007 TCTGGGGCCCCCGTGGTTCCTGG - Intronic
1176015929 20:62932240-62932262 CCTGGGCCTCCCAAAGTGTCAGG - Intronic
1176127484 20:63482467-63482489 TCTGGGCCCTGGATGGTGTGGGG - Intergenic
1176186497 20:63782850-63782872 CCTGGGCCTCCCATGGTGCTGGG - Intronic
1177908239 21:26998185-26998207 TCTGGGCCCCCCAAAGTGCTGGG + Intergenic
1178282189 21:31293072-31293094 TCTGGGCCTCCCAAAGTGTTGGG + Intronic
1178795197 21:35737614-35737636 TCAGAGCCACCCACGGTGTCTGG - Intronic
1179150377 21:38804635-38804657 TCTGGGTCCCCGAAGGTCTCCGG - Intergenic
1179843470 21:44093206-44093228 TCTGGGCCTCCCAAAGTGTTGGG - Intronic
1180049104 21:45323317-45323339 TCTGGGCGCCCCCTGATGCCAGG + Intergenic
1181348009 22:22234474-22234496 TCTTGGCCTCCCAAAGTGTCGGG - Intergenic
1181595818 22:23913828-23913850 TCTGCGCTCCCCATGGGGTCCGG + Intergenic
1182423961 22:30262492-30262514 TCTGGGCCCCCATGGGTGTGTGG - Intergenic
1182433991 22:30318493-30318515 TCTGGGCTCCCCAAGGTGCCTGG - Intronic
1182493773 22:30692359-30692381 TCTTGGCCTCCCAAGGTGTTGGG - Intergenic
1184812346 22:46844676-46844698 TCTGGGTCCCCCGTGGGGTCTGG + Intronic
950794298 3:15498107-15498129 TCTGGGCCCCCGCTGGCGTTGGG - Intronic
951876888 3:27437098-27437120 TCTAGGCCTCCCATAGTGTTAGG - Intronic
952669382 3:35947907-35947929 TCAGAGCTCCCCATGGTGTCTGG - Intergenic
953926503 3:46985352-46985374 TCTGGGAGCAGCATGGTGTCAGG + Intronic
954136211 3:48583330-48583352 TCTGGGCTCCCCATGGTGTTAGG - Intronic
954739081 3:52732443-52732465 TCTCGGCCTCCCAAGGTGTTGGG + Intronic
957695493 3:83633808-83633830 TCTTGGCCCCCCAAAGTGTTGGG - Intergenic
958557590 3:95700356-95700378 TCTGGGCCTCCCAAAGTGTTGGG - Intergenic
960056531 3:113279889-113279911 TCTCGGCCCTACGTGGTGTCGGG + Exonic
964737742 3:159933754-159933776 TCTGTACCCCCCATTGTATCTGG - Intergenic
964843721 3:161024024-161024046 TCTGGGCCTCCCAAGGTGTTGGG - Intronic
966423189 3:179754452-179754474 TCTGGGCCACACATGGTCTATGG + Intronic
968167751 3:196481319-196481341 CCTGGGCCTCCCAAGGTGCCTGG - Intronic
968492077 4:895420-895442 TCTTGGCCCACCCTGGTGACTGG - Intronic
968713433 4:2137543-2137565 TCCAGACCCCACATGGTGTCAGG - Intronic
968738999 4:2317881-2317903 CCTGGGCCTCCCAAGGTGCCTGG + Intronic
968883551 4:3314863-3314885 GCTGGCCCCCCGCTGGTGTCAGG + Exonic
971461937 4:26908732-26908754 TCTCGGCCTCCCAAGGTGTTGGG + Intronic
972725895 4:41746156-41746178 CCTGGGCCCCCAGTGCTGTCCGG + Exonic
972726791 4:41751802-41751824 TCTGGGCGCCCCCTGCTGCCGGG + Intergenic
973044542 4:45519572-45519594 TCTGTGCCCCCTAGGGTCTCAGG + Intergenic
973306486 4:48658485-48658507 CCTGGGCCCCCCAGAGTGTTGGG - Intronic
973730777 4:53820331-53820353 TCTTGGCCTCCCAAGGTGCCTGG + Intronic
974294024 4:59970961-59970983 TCTGGGCCTCCCAATGTGTTGGG + Intergenic
976608094 4:87001464-87001486 CCTCGGCCTCCCAAGGTGTCGGG + Intronic
978782541 4:112571633-112571655 TCTTGGCCTCCCAAAGTGTCGGG + Intronic
982110311 4:152047365-152047387 TCTTGGGCCTTCATGGTGTCAGG - Intergenic
982514347 4:156326266-156326288 TTTGGGCCCCAGCTGGTGTCTGG - Intergenic
985528393 5:419655-419677 CCGGGGCCCTCCATGGTGCCCGG + Intronic
986560260 5:9053648-9053670 TTAGTGCCCCCCATGGAGTCTGG - Intronic
986748726 5:10765916-10765938 TCTGTGCCCACCATGGTTTTAGG - Intergenic
986818326 5:11437351-11437373 TCTGTGCCCACCACGGTGCCAGG + Intronic
987092999 5:14524018-14524040 TCTTGGCCTCCCAAAGTGTCGGG - Intronic
987583407 5:19824353-19824375 TCTGGGCTCACCATGGAGACAGG + Intronic
988858382 5:35251789-35251811 CCTTGGCCCCCCATAGTGTTGGG + Intergenic
990415813 5:55585401-55585423 GCTGGGCCCTCTATAGTGTCTGG + Intergenic
993662077 5:90649737-90649759 CCTGGGCCCCCCAGGGTGCTGGG + Intronic
993974304 5:94457924-94457946 TCTGTGCCTGCCATGGTGCCTGG + Intronic
994535807 5:101027570-101027592 TCTAGGCCCCCAATCTTGTCTGG - Intergenic
995077328 5:108001748-108001770 TCTGGGCCTCCCAAAGTGTTGGG + Intronic
996320576 5:122210829-122210851 CCTCGGCCTCCCAAGGTGTCGGG + Intergenic
997175953 5:131778106-131778128 CCTGGGCCCCCCAAAGTGTTGGG - Intronic
997601102 5:135139077-135139099 GATGGGCCACCCATGGTGTTTGG + Intronic
997641535 5:135451835-135451857 GCTGGGCAACCCATGCTGTCAGG + Intronic
998668035 5:144321103-144321125 TCTCGGCCTCCCAAGGTGTTGGG + Intronic
998836355 5:146205768-146205790 CCTAGGCCCCCCAAAGTGTCGGG - Intronic
999933836 5:156463742-156463764 TCTGGGCCTCCCAAAGTGTTGGG - Intronic
1000099678 5:158003321-158003343 CCTTGGCCTCCCACGGTGTCAGG - Intergenic
1001950592 5:175814164-175814186 TCTGGGCCCAGCATGGGCTCTGG - Intronic
1002137936 5:177119735-177119757 TCTGGGCCTCCCAGAGTGTTAGG - Intergenic
1002454755 5:179339643-179339665 TCTGGGTTCCCTAGGGTGTCGGG - Intronic
1003027136 6:2565006-2565028 TCTTGGCCCCCCAAAGTGTTGGG + Intergenic
1003411407 6:5866010-5866032 TCTGTCTCTCCCATGGTGTCTGG - Intergenic
1006443214 6:34064798-34064820 ACTGGGCCTCGCATGGTGCCAGG - Intronic
1008098833 6:47369538-47369560 TCTTGGCCTCCCAAGGTGTTGGG + Intergenic
1011600180 6:89052638-89052660 CCTGGGCCCCCCAAAGTGTTGGG - Intergenic
1012215400 6:96576540-96576562 TCTGGGCCATCCATGGTGCTTGG - Intronic
1013272769 6:108559299-108559321 TCTGGGCCAGCCCCGGTGTCCGG - Intergenic
1014131950 6:117845551-117845573 CCTGGGCTCCGCATGGAGTCAGG + Intergenic
1016856796 6:148678815-148678837 TCTAGGCCCCTGATGGTGTTTGG - Intergenic
1019170461 6:170130716-170130738 TCTGGGCTCCCCAGTGTGCCCGG - Intergenic
1019486371 7:1291197-1291219 TCTGGGCCCCACATGCGGTCCGG + Intergenic
1019991874 7:4697484-4697506 TCTGGGGTCCACATGGTCTCCGG - Intronic
1023905209 7:44516971-44516993 TCTGGGGCCCTCATGGTGGGTGG + Intronic
1023959662 7:44915935-44915957 TCAGGGGCCCCCAGGGTCTCAGG + Intergenic
1024000251 7:45184897-45184919 ACTGTGCCCCCAATGGGGTCAGG - Intronic
1024026310 7:45412848-45412870 TCTGAACCCACCATGGGGTCGGG + Intergenic
1024718555 7:52108072-52108094 TCTTGGCCCCCCAAAGTGTTGGG + Intergenic
1025993975 7:66516656-66516678 TCTGGGCTTCCCAAGGTGTTGGG - Intergenic
1026034483 7:66821174-66821196 TCTGGGCCTCCCAAGGTGTTGGG + Intergenic
1026202565 7:68226979-68227001 CCTTGGCCCCCCAAAGTGTCGGG + Intergenic
1026830844 7:73609057-73609079 TCTTGGCCTCCCAAGGTGTTGGG + Intronic
1026985181 7:74550655-74550677 TCTGGGCCTCCCAAGGTGTTGGG - Intronic
1027191323 7:75997179-75997201 TCTCGGCCCCCCAAAGTGCCAGG - Intronic
1027425838 7:78060913-78060935 CCTTGGCCCCCCATAGTGTTGGG - Intronic
1032063328 7:128743953-128743975 TCTCGGCCTCCCAAAGTGTCGGG - Intronic
1034456126 7:151171569-151171591 CCTGGGCCTCCCAAAGTGTCGGG - Intronic
1034475684 7:151280205-151280227 TCTGTGCCTCCCCAGGTGTCAGG + Intergenic
1037327277 8:17705232-17705254 TCTTGGCCCCCCAAAGTGTTGGG + Intronic
1037860137 8:22399133-22399155 TCCAGTCCCCCCAGGGTGTCAGG - Intronic
1039906737 8:41791842-41791864 TCTGGGCCCCCCATGGTGTCTGG - Intronic
1044597318 8:93971158-93971180 TCTCGGCCTCCCAAGGTGCCGGG - Intergenic
1045280268 8:100743766-100743788 TCTGGGCCTCCCAAAGTGTTGGG - Intergenic
1045676781 8:104615784-104615806 TCTGAGCCTCCCAAGGTGTTGGG - Intronic
1047523504 8:125613664-125613686 CCTGGGCTCCCCGGGGTGTCGGG - Intergenic
1049332735 8:142063799-142063821 TCTGGGGGCTCCATGGAGTCAGG + Intergenic
1053346827 9:37384305-37384327 CCTGGGCCTCCCATGGTGCTGGG + Intergenic
1054867494 9:70017456-70017478 TCTTGGCCTCCCAAGGTGTTGGG + Intergenic
1058960854 9:109991487-109991509 TCTTGGCCTCCCAAGGTGTAAGG + Intronic
1060088602 9:120722948-120722970 CCTGGGCCTCCCAAAGTGTCAGG - Intergenic
1060135602 9:121150382-121150404 GCTGGGGCCCCCATGGTGTATGG + Exonic
1060942382 9:127550282-127550304 TCTGGGCTTCCCAATGTGTCAGG - Intronic
1061529373 9:131198199-131198221 TCAGGGACCCCCGTGGTGGCTGG - Exonic
1185447606 X:267763-267785 TCTGGGCCTCCCAGAGTGTTCGG + Intergenic
1186436099 X:9544264-9544286 GCTTGGGGCCCCATGGTGTCTGG + Intronic
1188523471 X:31063523-31063545 TCTGGGCCTCTCATGGTATTTGG - Intergenic
1190766631 X:53480765-53480787 TCTGTGCCCCCTAGGGTCTCGGG - Intergenic
1193385613 X:80868283-80868305 CCTGGGCCTCTCATAGTGTCGGG + Intergenic
1196820482 X:119696622-119696644 CTTGGGCCCAGCATGGTGTCTGG + Intergenic
1196898996 X:120364966-120364988 TCTTGGCCTCCCAAAGTGTCGGG + Intronic
1197804694 X:130387441-130387463 TCTGGGCCTCCCAAAGTGTTGGG + Intergenic
1198741400 X:139847132-139847154 TCTGGGCCTCCCAAAGTGTTGGG - Intronic
1200894647 Y:8362072-8362094 TCTTGGCCTCCCAAAGTGTCGGG - Intergenic
1201894119 Y:18975642-18975664 TCAGGGCCTCGCATGATGTCTGG + Intergenic