ID: 1039906740

View in Genome Browser
Species Human (GRCh38)
Location 8:41791857-41791879
Sequence GGCCCAGAGCTTTCTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039906725_1039906740 28 Left 1039906725 8:41791806-41791828 CCCTGGGGGAGGGCCACAGAGGC 0: 1
1: 0
2: 4
3: 47
4: 328
Right 1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG No data
1039906736_1039906740 -4 Left 1039906736 8:41791838-41791860 CCTTCCAGACACCATGGGGGGCC 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG No data
1039906737_1039906740 -8 Left 1039906737 8:41791842-41791864 CCAGACACCATGGGGGGCCCAGA 0: 1
1: 0
2: 2
3: 20
4: 304
Right 1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG No data
1039906728_1039906740 4 Left 1039906728 8:41791830-41791852 CCCCGCTGCCTTCCAGACACCAT 0: 1
1: 0
2: 0
3: 14
4: 177
Right 1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG No data
1039906726_1039906740 27 Left 1039906726 8:41791807-41791829 CCTGGGGGAGGGCCACAGAGGCT 0: 1
1: 0
2: 6
3: 40
4: 339
Right 1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG No data
1039906730_1039906740 2 Left 1039906730 8:41791832-41791854 CCGCTGCCTTCCAGACACCATGG 0: 1
1: 1
2: 5
3: 49
4: 463
Right 1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG No data
1039906729_1039906740 3 Left 1039906729 8:41791831-41791853 CCCGCTGCCTTCCAGACACCATG 0: 1
1: 0
2: 0
3: 44
4: 384
Right 1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG No data
1039906727_1039906740 15 Left 1039906727 8:41791819-41791841 CCACAGAGGCTCCCCGCTGCCTT 0: 1
1: 0
2: 8
3: 33
4: 328
Right 1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039906740 Original CRISPR GGCCCAGAGCTTTCTCAGGA AGG Intronic
No off target data available for this crispr