ID: 1039911131

View in Genome Browser
Species Human (GRCh38)
Location 8:41828080-41828102
Sequence CCCAGGGCCGCGAGCGCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039911120_1039911131 18 Left 1039911120 8:41828039-41828061 CCTATTAAAACAGACTAAGATCA 0: 1
1: 0
2: 0
3: 13
4: 196
Right 1039911131 8:41828080-41828102 CCCAGGGCCGCGAGCGCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039911131 Original CRISPR CCCAGGGCCGCGAGCGCTCA GGG Intronic
No off target data available for this crispr