ID: 1039911863

View in Genome Browser
Species Human (GRCh38)
Location 8:41832684-41832706
Sequence GAACCCTCTGGGAACCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039911863_1039911870 -7 Left 1039911863 8:41832684-41832706 CCCCCAGGGTTCCCAGAGGGTTC 0: 1
1: 0
2: 0
3: 18
4: 179
Right 1039911870 8:41832700-41832722 AGGGTTCCCAGAGGAAATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039911863 Original CRISPR GAACCCTCTGGGAACCCTGG GGG (reversed) Intronic
900236585 1:1594476-1594498 GAACCTGCTGAGACCCCTGGGGG - Intergenic
901027244 1:6285150-6285172 GACCCCTCTGGGGACCCACGAGG + Intronic
902886990 1:19412359-19412381 AAACCCACGGGGAACTCTGGTGG + Intronic
904403125 1:30269863-30269885 GAATCCTCTGGAAGTCCTGGGGG + Intergenic
913235564 1:116778445-116778467 GAACCCTCTGAGAAGACTGAAGG - Intergenic
915264457 1:154706645-154706667 GAACCCTTAGGGAACCTTGTGGG - Exonic
916275486 1:162989085-162989107 GAACCCTCTGAGGCACCTGGTGG + Intergenic
917012314 1:170488419-170488441 AAACCCTCTGGGCTCCCTGTAGG - Intergenic
920519804 1:206614812-206614834 GAACAGTCTGGGAGCCCTGTGGG - Intergenic
921080571 1:211735823-211735845 GACCCTCCTGGGAACCCGGGAGG + Intergenic
923135466 1:231114354-231114376 GAACACTCTGGGGACCAAGGCGG + Intergenic
923680367 1:236113785-236113807 GCACCCTCTGGAGGCCCTGGGGG + Intergenic
1063618391 10:7622186-7622208 GAGCCCCCTGGGAGTCCTGGTGG - Intronic
1067296666 10:44978681-44978703 GAAGCCCCTGGGAAGCTTGGGGG + Exonic
1068654416 10:59560009-59560031 GAGGCCTCTCGGAACCCTGGTGG - Intergenic
1070257114 10:74822407-74822429 GGAACCTCTGGGAACCCAGATGG - Intergenic
1072610447 10:97014187-97014209 CAGCCCTCTTGGAACACTGGTGG + Intronic
1072740469 10:97906115-97906137 GGGCCCCCTGAGAACCCTGGAGG + Intronic
1073751678 10:106535714-106535736 AAACCTTCTTGGAAGCCTGGGGG - Intergenic
1074205736 10:111281270-111281292 GAGCACTCTGAGAACCCTGGAGG - Intergenic
1074808070 10:117073894-117073916 GAAACCTCAGGGAGCTCTGGAGG - Intronic
1074872104 10:117585314-117585336 GATCTCTCTGGCTACCCTGGTGG + Intergenic
1075041002 10:119106584-119106606 TAACACTTTGGGAACCCAGGAGG - Intronic
1075592862 10:123705050-123705072 GGACCCTGCGGGAACCATGGAGG + Intergenic
1076698058 10:132256645-132256667 GACCCCTCTAGGCAGCCTGGGGG - Intronic
1076813000 10:132898843-132898865 GCACCCTCTGGGAGGCCTGTGGG + Intronic
1077143101 11:1033481-1033503 GACCCCTCAGGGAAACCAGGCGG - Intronic
1079131349 11:17748715-17748737 GAACACTCAGGGAACCCATGGGG - Intronic
1081672667 11:44950485-44950507 GAGCCCGCTGGGACCCCAGGGGG - Intronic
1082020982 11:47533035-47533057 GAACCCACTAGGATTCCTGGGGG + Intronic
1083587413 11:63870319-63870341 CAACACTCTGGGAACCCAGGTGG - Intronic
1083672644 11:64307540-64307562 GCACCCTCTGGGTACACTGCTGG + Intronic
1084497318 11:69512694-69512716 GAACCCTCAGGGTACCTGGGAGG - Intergenic
1084650943 11:70488854-70488876 GAACCCTCAGGCCACCCTGCTGG - Intronic
1088728146 11:112657465-112657487 GAACCCTCTGCAGGCCCTGGAGG + Intergenic
1088742010 11:112774905-112774927 GAGGCCTGTGGGAATCCTGGAGG - Intergenic
1089561680 11:119346301-119346323 GCATCCTCTGGGAAAACTGGGGG + Exonic
1090253304 11:125265699-125265721 CAACCCTCTGGGGACCATTGGGG - Intronic
1090744577 11:129695927-129695949 CAGCTCTCTGGCAACCCTGGGGG + Intergenic
1090806854 11:130208325-130208347 GAATCCTCTGGGAACGCGCGGGG + Intronic
1090939997 11:131379095-131379117 GAACACTCTGGGGAGCCAGGTGG - Intronic
1093977719 12:25441013-25441035 GAGCCATCTGGAAACCCTGTAGG + Intronic
1094637585 12:32241471-32241493 GTGCCCTCTGGGAAACATGGAGG + Intronic
1103258249 12:119562076-119562098 GAACACTCTTGGACTCCTGGAGG + Intergenic
1104017712 12:124971678-124971700 GAAGCCACTGGGACTCCTGGGGG - Intronic
1104042453 12:125139352-125139374 GAACCCGCTGTGAAGGCTGGCGG - Intronic
1106128563 13:26920985-26921007 CCAGCCTCTGGGAAGCCTGGGGG - Intergenic
1112870312 13:103962873-103962895 GAACCCTTTGAGAACCCATGTGG - Intergenic
1113452644 13:110422553-110422575 GACCCCTCTGGGACACGTGGAGG + Intronic
1116309183 14:43300284-43300306 GGAGCCCCTGGGAACCGTGGCGG + Intergenic
1117507018 14:56414294-56414316 GAACCCTCTGGGACCACAGTTGG + Intergenic
1119238531 14:73039863-73039885 GAATCATCTGGGAACCTTTGGGG - Intergenic
1121406674 14:93723212-93723234 GGCACCCCTGGGAACCCTGGAGG - Intronic
1121412389 14:93756922-93756944 GAACCCCCTGGGTACCGTGGAGG - Intronic
1123005184 14:105317999-105318021 GGACACTCTGGGAACCCAGGAGG - Intronic
1124859903 15:33429202-33429224 AAGTCCTCTGGGGACCCTGGTGG - Intronic
1128390994 15:67182454-67182476 GAACCCTTTGCCAACCCTTGGGG - Intronic
1128659087 15:69484750-69484772 GAATCCTGAGGGAACCATGGAGG - Intergenic
1129117519 15:73373342-73373364 AAACCCTCTGAGAAGGCTGGGGG + Intergenic
1132665521 16:1079801-1079823 GAACCTTCTGGAAGCTCTGGCGG - Exonic
1132797038 16:1729701-1729723 GAACACTCTGGAGACCCAGGAGG + Intronic
1136025039 16:27463577-27463599 AAACTCTCTGTGAACCCTGAGGG + Exonic
1136355095 16:29739484-29739506 GAAACCTCTTTGAACCTTGGTGG + Intergenic
1137574971 16:49593512-49593534 GAACCCTCTCTGAAGTCTGGCGG + Intronic
1138578293 16:57922901-57922923 GAACCCACTGGAGATCCTGGTGG + Intronic
1138760131 16:59533522-59533544 GAAGCCTCTGGGAAACATGCAGG - Intergenic
1140838435 16:78817082-78817104 TAACCCTCTGTAATCCCTGGTGG + Intronic
1141330052 16:83102631-83102653 GACCGCTCTGGCCACCCTGGGGG + Intronic
1142139407 16:88466056-88466078 GCACCCACTGGGAGCCCAGGCGG - Intronic
1142380776 16:89730758-89730780 GACCCCCCTGGGAACCCAGAAGG + Intronic
1142429070 16:90016660-90016682 CAGCCCTCAGGGAAGCCTGGGGG - Intronic
1142864290 17:2780980-2781002 GAACCATCTGGAATCCCTGAAGG - Intronic
1143849359 17:9798316-9798338 GAACCCTCTTGGAACCATCTGGG - Intronic
1144082832 17:11780344-11780366 GAACTCTCTGGGAACACTGTTGG + Intronic
1147464252 17:40598546-40598568 GGGCCCTCTGGGAATCCTGTCGG - Intergenic
1147685037 17:42282046-42282068 GAGTCTTCTGGGAACCATGGTGG + Intergenic
1148326632 17:46786844-46786866 GAACATTCTAGAAACCCTGGTGG + Intronic
1150693476 17:67384304-67384326 AAACTCTCTGGGGACCCTGGGGG - Intronic
1151404605 17:73878272-73878294 GAACACTCAGGCTACCCTGGAGG + Intergenic
1154082906 18:11275915-11275937 GAAGACTCTGGCAGCCCTGGAGG - Intergenic
1157718330 18:49904737-49904759 GGACCCTCTGGTAGGCCTGGCGG + Exonic
1161468019 19:4442867-4442889 GGGCCCTCTGGGCTCCCTGGGGG - Intronic
1161585195 19:5102001-5102023 GACCCCTCCTGGCACCCTGGCGG - Intronic
1161710477 19:5844687-5844709 GGACCCACTGGGAGCCCTAGGGG + Exonic
1162032642 19:7924087-7924109 GCACCCTCTGCCAGCCCTGGAGG - Intergenic
1162304023 19:9860618-9860640 GAACCTTCCAGGTACCCTGGGGG - Intronic
1163290471 19:16376421-16376443 GAATCCTCAGGGGACCCTCGAGG + Intronic
1164712600 19:30368097-30368119 GAAGAATCTGGGAACCCAGGAGG - Intronic
1165870352 19:38967974-38967996 GAACCCTCAGGCATCGCTGGTGG + Intronic
1168346104 19:55650923-55650945 GTAGCCTCTGGAAACCCAGGAGG - Intronic
926655160 2:15395917-15395939 GAACCCTCATGCAACACTGGAGG - Intronic
931989556 2:67776367-67776389 AAACCCTCAGGGATCCCTAGAGG + Intergenic
932515772 2:72347134-72347156 GAAGCATTTGGGAACCTTGGAGG - Intronic
934622923 2:95826520-95826542 AAACCCTCTGAGTTCCCTGGGGG - Intergenic
934730456 2:96653217-96653239 AAACCCTCTAGGAGCCCGGGAGG + Intergenic
934810848 2:97275583-97275605 AAACCCTCTGAGTTCCCTGGGGG + Intergenic
934826844 2:97432356-97432378 AAACCCTCTGAGTTCCCTGGGGG - Intergenic
935332856 2:101989766-101989788 GAATCCTCTGAAAACCCTTGTGG - Intergenic
935692028 2:105740624-105740646 GAAGCCTGTCTGAACCCTGGAGG - Intergenic
935713509 2:105919499-105919521 CTACCCTCTGGGATCCCTGAAGG - Intergenic
936917782 2:117657498-117657520 GAACCCTCAGGGAACACATGGGG - Intergenic
937399340 2:121568284-121568306 CACCCCTCCCGGAACCCTGGGGG + Intronic
938418150 2:131121493-131121515 CAACACTTTGGGAACCCAGGTGG - Intronic
943611320 2:190038316-190038338 GCACCCTCTTGGATACCTGGTGG + Intronic
1169249421 20:4048756-4048778 TAAGCCACTGGGAGCCCTGGAGG - Intergenic
1173853922 20:46237607-46237629 GAACCAGCTGGGAACCAAGGAGG - Intronic
1175213773 20:57378633-57378655 GCAGCCTCTGTGAGCCCTGGTGG + Exonic
1175276419 20:57774096-57774118 TAGCCCTCTGGGGCCCCTGGAGG + Intergenic
1176032790 20:63021759-63021781 GAACCATCCGGGAACCCAGAGGG - Intergenic
1176056227 20:63150666-63150688 GATCCCACTGGGAGACCTGGTGG - Intergenic
1176197478 20:63844158-63844180 GCTGCTTCTGGGAACCCTGGGGG + Intergenic
1176375483 21:6085130-6085152 GTCGCCTCTGGGAACCCTGGGGG + Intergenic
1178193499 21:30315056-30315078 GAAACCTGTGGGATCCCTAGAGG + Intergenic
1179747991 21:43453114-43453136 GTCGCCTCTGGGAACCCTGGGGG - Intergenic
1181050206 22:20234731-20234753 GAAACCCCTGGCATCCCTGGAGG + Intergenic
1181106636 22:20579558-20579580 GAACCCTCAGGCAAGGCTGGCGG - Intronic
1184370215 22:44077207-44077229 GGATCCTCTCGGAGCCCTGGAGG - Intronic
1184688059 22:46105243-46105265 GGACCCTGTGGGAGCCCTGTGGG + Intronic
1184688063 22:46105254-46105276 GAGCCCTGTGGGAGCCCTGTGGG + Intronic
1185178888 22:49348030-49348052 GAGCCCTCTCTGCACCCTGGAGG + Intergenic
1185178912 22:49348165-49348187 GAGCCCTCTCTGTACCCTGGAGG + Intergenic
1185178959 22:49348405-49348427 GGGCCCTCTCTGAACCCTGGAGG + Intergenic
1185333154 22:50260636-50260658 GAACCCTCAGGAGCCCCTGGGGG - Intronic
1185413898 22:50699500-50699522 GAACCCTCAGGGGTCCCGGGAGG + Intergenic
950097661 3:10339230-10339252 TAAACCCCTGGGCACCCTGGGGG - Intronic
959068190 3:101678402-101678424 GCACCCTCTGCGAACCCAGGAGG + Intergenic
959219178 3:103494133-103494155 GAAACCACTGGGAAACTTGGAGG + Intergenic
961492114 3:127263458-127263480 TTGGCCTCTGGGAACCCTGGGGG + Intergenic
962250378 3:133832647-133832669 GGTCCCTCTGGGACCTCTGGTGG + Intronic
962927888 3:140011931-140011953 GAACCCTCTGGGAGACCTGAAGG + Intronic
963007871 3:140742748-140742770 GTACCCTCTGGACAGCCTGGTGG - Intergenic
963043191 3:141083907-141083929 GAACCCTCTGGAGGCCCTGCAGG + Intronic
964302595 3:155305713-155305735 CAACACTTTGGGAACCCTAGGGG + Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968682197 4:1928990-1929012 GACCCCACAGGGAACACTGGTGG + Intronic
968909450 4:3470094-3470116 AGCCCCTCTGGGAAGCCTGGAGG - Intronic
969121352 4:4913728-4913750 GAAGCTGCTGGGAACCCTGGAGG + Intergenic
969202403 4:5616384-5616406 GAATGGTCTGGGAGCCCTGGGGG + Intronic
972589080 4:40467174-40467196 GAACCCTCTCTGGACCCTGCAGG - Intronic
973034680 4:45391033-45391055 GAACCCTCTGGGCTCCATGCAGG + Intergenic
976146067 4:82043963-82043985 GTCCCCTCAGGGACCCCTGGCGG - Intronic
977848216 4:101791093-101791115 GAACCCTCTGGGCTGCCTGGCGG - Intronic
978758076 4:112325759-112325781 GAAACATTTGTGAACCCTGGAGG - Intronic
980053984 4:128062194-128062216 GCCCCCGCTGGAAACCCTGGAGG + Intronic
983605257 4:169575611-169575633 GAACTCACTGGGAAGCCTGCTGG - Intronic
985547821 5:518911-518933 GTACCCACAGGGAGCCCTGGTGG + Intronic
985705735 5:1400492-1400514 GAAGCCACAGGGAGCCCTGGAGG - Intronic
985776406 5:1846414-1846436 GAAAACTCTGGGAACACTGGAGG - Intergenic
993531815 5:89034759-89034781 GCACTCTCTGGGTACCCTGCAGG + Intergenic
999812602 5:155142124-155142146 GAATCCTCTCGGAACTCTGCAGG - Intergenic
999865944 5:155700655-155700677 GAACCCACTGGGAAGCCAGCTGG - Intergenic
1001322175 5:170691762-170691784 GAACGCTCAGGGGACCCTGCTGG - Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1004819948 6:19356805-19356827 AAACCCTCTAGGAACACTGAGGG - Intergenic
1005217492 6:23548158-23548180 GCAGCCTCTGGGCACACTGGAGG - Intergenic
1006175877 6:32121218-32121240 GAACTCACTGGAAAACCTGGAGG + Intronic
1006365691 6:33613892-33613914 GAATTCTCTGGGAACCCCAGCGG + Intergenic
1006838586 6:37014110-37014132 CAGCCCCCTGGGACCCCTGGGGG - Intronic
1006867698 6:37222445-37222467 GCACCCTCGGGGACCCCAGGAGG - Intronic
1012998401 6:105995282-105995304 CAGCCCTCTGGGCACTCTGGGGG + Intergenic
1017020599 6:150137030-150137052 TCACCCTCTGGGCACTCTGGAGG + Intergenic
1018105668 6:160483909-160483931 GAATCCTCAGGGCACTCTGGGGG - Intergenic
1018799904 6:167213921-167213943 GAACCTCGTGGGAAGCCTGGAGG + Intergenic
1019951644 7:4377852-4377874 GGAGCTTCTGGGAATCCTGGAGG + Intergenic
1023622365 7:42086697-42086719 GAGCCCCCTGGGAAGCCTGATGG - Intronic
1024087340 7:45905731-45905753 GAACCCTCTTAGAATACTGGTGG + Intergenic
1024554565 7:50592414-50592436 GGACCCTCTGGGAACATTTGGGG + Exonic
1036558801 8:9884183-9884205 AAGGCCCCTGGGAACCCTGGAGG + Intergenic
1036602395 8:10274002-10274024 GAAGCCTCTGGGAACCAGGAAGG + Intronic
1037627298 8:20619215-20619237 GAAGACTCTGGGAATCCTGGGGG + Intergenic
1037682125 8:21106297-21106319 GAAGCCTCTGTGGGCCCTGGTGG + Intergenic
1039911863 8:41832684-41832706 GAACCCTCTGGGAACCCTGGGGG - Intronic
1045271240 8:100663538-100663560 GAGCCCTCTGGAAACCCTATCGG + Intergenic
1046226934 8:111294461-111294483 GAACCCTCTGCTAACTCTTGGGG - Intergenic
1047765417 8:127986269-127986291 GAACCTCCTGGGAGCCTTGGAGG + Intergenic
1050061967 9:1718860-1718882 GAACCCAGTGGGAAGTCTGGAGG - Intergenic
1050610756 9:7350386-7350408 GAAGCCTCTGAGTACCCAGGTGG + Intergenic
1050626632 9:7511067-7511089 TAACCCACTGAGAACCCTGGAGG + Intergenic
1055938752 9:81628390-81628412 GAGGCCTATGGGAACCATGGCGG - Intronic
1056326830 9:85486969-85486991 GACCCCACTGGGGACACTGGAGG + Intergenic
1057427979 9:94969291-94969313 GACCCCTCTGCAAACCCTGTCGG - Intronic
1057514143 9:95706777-95706799 GAAACCTCTGGGAACAGAGGAGG + Intergenic
1058887572 9:109333147-109333169 GAACCCTCAGGCATTCCTGGTGG + Intergenic
1058952836 9:109919526-109919548 GAATCCTCTGAGAAATCTGGAGG - Intronic
1059815458 9:117908063-117908085 AAACCATTTGGGAACTCTGGAGG + Intergenic
1060010605 9:120040111-120040133 GAAGTCTCAGGGAAGCCTGGTGG + Intergenic
1062389871 9:136329758-136329780 GAGCCCACTGGGTACCCTGAGGG + Intronic
1062583372 9:137237936-137237958 GAACCGTCTGGCACCCCTGTAGG + Intergenic
1186163672 X:6804655-6804677 GATCTCTCTGGGAATCCAGGAGG - Intergenic
1187141807 X:16601293-16601315 GCACCCTCTGTGAACAATGGAGG + Intronic
1187670155 X:21658608-21658630 GGACCCTCTGGTGACACTGGTGG - Intergenic
1189215643 X:39320789-39320811 GAACCCTCTGAGAAACCAGGTGG + Intergenic
1189971040 X:46418562-46418584 GAACCCTCTGGCAAATCTGGGGG + Intergenic
1192548869 X:72037712-72037734 GAACCTTCTGCCAACACTGGGGG - Intergenic
1195143065 X:101983519-101983541 GAATCATCTGGGATCCTTGGCGG + Intergenic
1196081037 X:111631239-111631261 GAAGGCTCAGGGAAGCCTGGAGG - Intergenic
1200074525 X:153544539-153544561 GAACCCTGAGGGGGCCCTGGAGG + Intronic
1201447973 Y:14079251-14079273 GAAACCTTTGGGAACCCACGAGG + Intergenic