ID: 1039914487

View in Genome Browser
Species Human (GRCh38)
Location 8:41849630-41849652
Sequence CTCGGATCCCACCGCCGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039914482_1039914487 -2 Left 1039914482 8:41849609-41849631 CCTGAGCATGACAATGATCCCCT 0: 1
1: 0
2: 1
3: 13
4: 251
Right 1039914487 8:41849630-41849652 CTCGGATCCCACCGCCGCGCAGG No data
1039914480_1039914487 20 Left 1039914480 8:41849587-41849609 CCCTTGAAGGCAAAGGCAGGATC 0: 1
1: 0
2: 2
3: 16
4: 254
Right 1039914487 8:41849630-41849652 CTCGGATCCCACCGCCGCGCAGG No data
1039914479_1039914487 21 Left 1039914479 8:41849586-41849608 CCCCTTGAAGGCAAAGGCAGGAT 0: 1
1: 0
2: 2
3: 20
4: 268
Right 1039914487 8:41849630-41849652 CTCGGATCCCACCGCCGCGCAGG No data
1039914481_1039914487 19 Left 1039914481 8:41849588-41849610 CCTTGAAGGCAAAGGCAGGATCC 0: 1
1: 1
2: 1
3: 22
4: 269
Right 1039914487 8:41849630-41849652 CTCGGATCCCACCGCCGCGCAGG No data
1039914478_1039914487 22 Left 1039914478 8:41849585-41849607 CCCCCTTGAAGGCAAAGGCAGGA 0: 1
1: 0
2: 1
3: 42
4: 819
Right 1039914487 8:41849630-41849652 CTCGGATCCCACCGCCGCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039914487 Original CRISPR CTCGGATCCCACCGCCGCGC AGG Intronic
No off target data available for this crispr