ID: 1039916143

View in Genome Browser
Species Human (GRCh38)
Location 8:41861741-41861763
Sequence CCTCCCAGATACCTGTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039916143_1039916147 -9 Left 1039916143 8:41861741-41861763 CCCATGGACAGGTATCTGGGAGG 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1039916147 8:41861755-41861777 TCTGGGAGGACCCAAGGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039916143 Original CRISPR CCTCCCAGATACCTGTCCAT GGG (reversed) Intronic
904447524 1:30587158-30587180 TCTCCCAGATCCCTGACCACAGG + Intergenic
904470066 1:30730534-30730556 CCTCCCAGCTGCCTGGCCACAGG + Intergenic
911530467 1:99037476-99037498 CTTCCCAGAGACCTGTTCAATGG - Intergenic
913694988 1:121316124-121316146 CCTCCCAAATACCCGTCCCTGGG - Intronic
914142573 1:144963934-144963956 CCTCCCAAACACCCGTCCCTGGG + Intronic
914908756 1:151768137-151768159 CCTCCCAGACCTCTGCCCATTGG + Exonic
916643713 1:166760602-166760624 ACTCCCTGAAACCTGTTCATAGG - Intergenic
916828627 1:168468027-168468049 CCTCCCAGAAACCTTTGCAAAGG + Intergenic
920482321 1:206334507-206334529 CCTCCCAAATACCCGTCCCTGGG - Intronic
920496310 1:206457365-206457387 CCTGTCAGTTACCTGTCCATAGG - Intronic
923921087 1:238565239-238565261 CCTCCCAGGTAGCTGGCCAAGGG + Intergenic
924941249 1:248813586-248813608 ACTCCCAGATCCCTAACCATTGG - Intronic
1063040175 10:2329726-2329748 CCTCCCAGGAACGTGTTCATTGG + Intergenic
1063664126 10:8051609-8051631 CCTCCCAGGTACCTGGGCCTCGG - Intergenic
1063938203 10:11100766-11100788 TCTCCAAGGTACCTGTTCATTGG - Intronic
1064105913 10:12501037-12501059 GCACCCAGATCCCTGTCCACCGG + Intronic
1071525277 10:86354706-86354728 CCTCCCCGGGACCTGGCCATAGG - Intronic
1071542618 10:86501201-86501223 CTATCCAGAAACCTGTCCATAGG + Intronic
1071787787 10:88921868-88921890 CATCCCTGATACCTGCCCATCGG + Intronic
1071797888 10:89025588-89025610 CATGCCAGATACCATTCCATGGG - Intergenic
1074059392 10:109951022-109951044 CCTCTCAGATAAATGTCCCTAGG + Intronic
1074404831 10:113171934-113171956 ACTCCCAGGCACCTGGCCATCGG + Intergenic
1076675911 10:132147655-132147677 CCTTCCACATCCCTGTCCAGGGG + Intronic
1078328929 11:10402686-10402708 CTTCCCACATACATGTCCAATGG - Intronic
1078428087 11:11267536-11267558 CCAACAAAATACCTGTCCATGGG + Intergenic
1080723370 11:34870875-34870897 CCACCCAGATCCCTTTTCATGGG - Intronic
1083280906 11:61626898-61626920 CCTCCCAGCAACATGTCCAGGGG - Intergenic
1087203631 11:95371240-95371262 CCCCCCAGATACATTTCCACAGG - Intergenic
1088210704 11:107453305-107453327 CCCCCCAACCACCTGTCCATTGG - Intronic
1094294992 12:28895755-28895777 ACTTCCAGATATATGTCCATGGG + Intergenic
1099950244 12:89293909-89293931 CCTCCAAGATTCCTGCCCCTTGG - Intergenic
1101259211 12:103012237-103012259 CCTCCCAGAATCCTGTCACTAGG + Intergenic
1102769126 12:115458014-115458036 CCTCGCAGATGCCTGCTCATGGG - Intergenic
1106009171 13:25801475-25801497 CCTCCCACATCCCTGTCTGTGGG + Intronic
1113397490 13:109962163-109962185 CCTCCCAGTTACATGTCCAGTGG + Intergenic
1113628274 13:111862648-111862670 CTTCCGAAATACCTGTTCATTGG + Intergenic
1118692390 14:68352613-68352635 CCTCACAGATGCCTGGGCATAGG + Intronic
1124604894 15:31162613-31162635 CCTCCCACATCCCTGCCCAGTGG - Intergenic
1125672177 15:41481581-41481603 CCTCCCTGGTACCTGGCCATGGG - Exonic
1126474951 15:49055526-49055548 CCTAACAGGTACTTGTCCATGGG - Intergenic
1129849070 15:78781438-78781460 CCTCCCAAACACCCCTCCATTGG + Intronic
1130379216 15:83357393-83357415 CCTTCCAGTTTCCTGTCCTTAGG - Intergenic
1131757738 15:95583944-95583966 CCTTCCAGGTACCTGGCCTTAGG - Intergenic
1134390342 16:13814166-13814188 CCCCACAGGTACCTCTCCATAGG + Intergenic
1135275678 16:21110415-21110437 CCTCCCGGATTCCTATCCAGAGG - Intronic
1137792197 16:51184773-51184795 CCTCCCAAGTACGTGTCCCTAGG - Intergenic
1143213900 17:5209841-5209863 CCTTCCAGATCACTGTCCCTGGG - Exonic
1143769409 17:9158460-9158482 CCTTCCAGATCCCTGTCCCCAGG + Intronic
1144411883 17:15009654-15009676 CATCACAGATACGTGGCCATGGG - Intergenic
1144880857 17:18429915-18429937 TCTCCAAGACACCTGTCCGTGGG - Intergenic
1147477540 17:40727004-40727026 CTTCCCAGATATCTGGCCCTGGG - Intergenic
1147598007 17:41728883-41728905 ACTCCCAAATAGCTTTCCATTGG - Intronic
1150089280 17:62307458-62307480 CCTTCCAGACACCTGACTATTGG + Intergenic
1150251310 17:63706170-63706192 CCCTCCAGATGCCTGTCCTTTGG - Intronic
1153539173 18:6135726-6135748 CCTCCCAGAGACTTGTCGAGTGG - Intronic
1158706232 18:59794855-59794877 CCTCCCATACACCAGTACATGGG - Intergenic
1160436870 18:78858522-78858544 CCTCGGAGGTACCTGTCCAGAGG + Intergenic
1161281376 19:3447584-3447606 CGTCCCAGATCCCTGGGCATCGG - Intronic
1161443850 19:4306986-4307008 CATCCCAGATTCCTGTCCCAGGG + Intronic
1163157661 19:15448288-15448310 CCTGCCAGAGACCCCTCCATCGG + Exonic
1164304066 19:23988085-23988107 CCTGCCTGGTCCCTGTCCATAGG - Intergenic
1164777701 19:30865893-30865915 TCTCCCAGATCAGTGTCCATAGG + Intergenic
1164939253 19:32239335-32239357 TCTCCCAGATACCTTACAATGGG + Intergenic
1165004225 19:32791344-32791366 CCTCCCACAGCCCTGTCCACAGG - Intronic
1166988140 19:46674584-46674606 CCACCGAGATCCCTGTCCGTGGG + Exonic
1167571613 19:50292411-50292433 CCTCCCAGCTTCCTGTCCCAGGG - Intronic
926977197 2:18526759-18526781 CCTCCCAGAAACCTCACCCTGGG - Intergenic
931242074 2:60462225-60462247 CTTCCCAGCCACCTCTCCATGGG - Exonic
931264024 2:60644548-60644570 CCTCACAGAATTCTGTCCATGGG - Intergenic
931483279 2:62665090-62665112 GCTTCCAGATGCCTGTGCATGGG + Intergenic
938936736 2:136133815-136133837 CCTCGCAGCTAGCTGTCCATAGG + Intergenic
940320653 2:152372904-152372926 ACTCCCAGATACCTCTTCTTGGG - Intronic
940339890 2:152569209-152569231 CTTGCCAGATACATGTTCATAGG - Intronic
940447699 2:153796217-153796239 CATCCCAGAAACCTGACCATGGG - Intergenic
942132336 2:172892611-172892633 TGTCCCAGATTCCTGTCCTTTGG + Intronic
942891628 2:180996637-180996659 CCTCCAAGATACCTGGAAATGGG - Intronic
944215885 2:197255239-197255261 CCTCACAGAGCCCTGTCTATGGG + Intronic
945326208 2:208485704-208485726 CCCCCAAGATTCCTGCCCATGGG + Intronic
945577644 2:211552106-211552128 GCGCACAGATACCTGTCCCTGGG + Intronic
946686107 2:222271797-222271819 CCTCCTAGCTACCTTCCCATTGG + Intronic
946792565 2:223316123-223316145 CCTCCCAGTCTCCTGTCCACAGG + Intergenic
948303578 2:236929126-236929148 CCTCCCAGATAACTAGCCAATGG - Intergenic
948836811 2:240629852-240629874 CCTCCCACATCCCTGCCCAGAGG + Intronic
1168750525 20:278526-278548 ACTCCCAGAAACCTGACCAGAGG + Intronic
1169960604 20:11155461-11155483 CCTACAAGATACCAGTCCATAGG + Intergenic
1171295417 20:24012694-24012716 CCTACCAGAGACAGGTCCATAGG - Intergenic
1174694190 20:52541011-52541033 GCTCCCAGCCACCTGTCCTTTGG + Intergenic
1174697677 20:52576805-52576827 CATCCCAAATGCCTGTCCATAGG - Intergenic
1175563944 20:59957974-59957996 CCACAGAGATCCCTGTCCATAGG + Intergenic
1175597636 20:60247988-60248010 CCTCTCAGAACCCTGTTCATGGG + Intergenic
1175988551 20:62776444-62776466 CATCCCACACACCTGTCCCTGGG + Intergenic
1176137458 20:63530450-63530472 CCTCCCAGTTCCCTGTCCCCCGG - Intronic
1177200400 21:17947794-17947816 ACTCCTAGATATCTGTCCAAAGG + Intronic
1181020897 22:20101771-20101793 CCTCCCAGCTGCCTGTGCAGAGG + Intronic
1182521101 22:30884904-30884926 CCGCTCAGATGCCTGCCCATTGG - Intronic
1182645941 22:31809412-31809434 CCTCTCACAAACCTGTCCACTGG - Intronic
949991071 3:9579654-9579676 CCTCCAAGTTATCTGTCCATTGG + Intergenic
950936778 3:16847226-16847248 CCTCTCAGAGACTTGGCCATGGG + Intronic
951711816 3:25591103-25591125 CCTCCCAGATACTTGCCCAGGGG - Intronic
952867444 3:37863254-37863276 CCTCCCAGAGAGCTGGCCAAGGG + Intronic
953743849 3:45558104-45558126 CCTCCCAGAGGCCTCTCCATGGG - Intronic
955822613 3:62912082-62912104 CCGCCAAGATACTTGTCCTTGGG + Intergenic
956726770 3:72162953-72162975 CCTCCCAGTGACCTGGCCTTAGG - Intergenic
960641003 3:119822952-119822974 CCTCTCAGAAACCTTTGCATTGG + Intronic
962194834 3:133352695-133352717 CCTCCCATATACCTTGCCCTAGG - Intronic
967723662 3:192841675-192841697 ACTCCCAGATTCCTGACCCTCGG + Intronic
968033806 3:195527743-195527765 CCTCCCAGGTAGCTGACTATGGG - Intronic
969440216 4:7212588-7212610 CCTCCCAGGTCCTGGTCCATGGG + Intronic
974781919 4:66562938-66562960 CCTTCAAGATTCCTGTCCCTTGG - Intergenic
975455422 4:74584683-74584705 CCTCCCAGATCCCTCTTCAATGG - Intergenic
982694105 4:158580188-158580210 CTTCCCAGCTACCTGGCCCTAGG + Intronic
983302529 4:165945793-165945815 ACCCCAAGATACCTGTCCACAGG + Intronic
985933425 5:3077272-3077294 CCTCCCAGGCAGCTTTCCATTGG - Intergenic
991645986 5:68800725-68800747 ACTCCCAGATTCCTGAGCATAGG + Intergenic
993058953 5:83016068-83016090 CCTCCCAGCTACCTTTCCCAGGG - Intergenic
999131777 5:149289070-149289092 CCTCACACAAACCTGTGCATGGG + Intronic
999303607 5:150506231-150506253 CCTCCCATATAACTGACTATAGG + Intronic
1001695690 5:173668071-173668093 TCTCCCAGACACTTTTCCATGGG + Intergenic
1002433814 5:179219583-179219605 GCTCCCAGATACGTGTCCTTGGG + Intronic
1005580583 6:27230576-27230598 CCACGCGGACACCTGTCCATTGG + Intergenic
1006055769 6:31383686-31383708 TCTCCCAGATTCCTGACCACTGG - Intergenic
1007273762 6:40658527-40658549 CCTCCCAGCTTCCTGTCCTTAGG + Intergenic
1010471019 6:76228706-76228728 CTTCCCAGATAACTCTTCATAGG + Intergenic
1012160098 6:95873722-95873744 CCACACAGCTACCTTTCCATGGG - Intergenic
1019031836 6:169020194-169020216 CCTCCCAGATTCAAGTCCAGGGG - Intergenic
1021052797 7:16009931-16009953 CCTCCCAGAACCCTGGCCCTAGG - Intergenic
1022376380 7:29815546-29815568 GAGCCAAGATACCTGTCCATAGG + Intronic
1023727440 7:43158716-43158738 CCACCCAGCTACCTCTCCCTGGG + Intronic
1026909853 7:74085167-74085189 ACTCCCAGACACCTGTCCCAGGG - Intronic
1030585607 7:111414888-111414910 CATCCCAGATTCCTGCCCACTGG + Intronic
1037559124 8:20056101-20056123 CCTCCCAGAACCCAGTCCTTTGG + Intergenic
1038855118 8:31322443-31322465 GCCCCCACATACCTCTCCATGGG + Intergenic
1039916143 8:41861741-41861763 CCTCCCAGATACCTGTCCATGGG - Intronic
1042060857 8:64815884-64815906 CTTCTCAGACACCTCTCCATGGG - Intergenic
1043031507 8:75139246-75139268 CCTCCCAGGTAACTTTCCAGAGG - Intergenic
1048633041 8:136265378-136265400 CCTGTCAGTTACCTGTCAATGGG + Intergenic
1048959262 8:139562311-139562333 CCTCCCTGGTACCTGTCAACAGG - Intergenic
1048985452 8:139732439-139732461 CCTCCCAGAGGCCCCTCCATTGG - Intronic
1051511925 9:17887917-17887939 CCTCCCAAATTCCTGTCCCCTGG + Intergenic
1053265230 9:36708062-36708084 CCTGCCATATTCCTGTTCATGGG + Intergenic
1055300595 9:74878038-74878060 CCTCCCAGAAACCTGAGAATGGG + Intronic
1061379074 9:130243561-130243583 CCTCCCAGATGCCTGTCGCGTGG + Intergenic
1186987844 X:15036084-15036106 GCTCCCAGACACTTGCCCATTGG - Intergenic
1197825448 X:130585243-130585265 CCTCCAAGATTCCTGGCCCTTGG + Intergenic
1202251915 Y:22881734-22881756 CCTGCCAGTTCCCTGTCCACTGG - Intergenic
1202404903 Y:24515483-24515505 CCTGCCAGTTCCCTGTCCACTGG - Intergenic
1202465876 Y:25154599-25154621 CCTGCCAGTTCCCTGTCCACTGG + Intergenic