ID: 1039916998

View in Genome Browser
Species Human (GRCh38)
Location 8:41867482-41867504
Sequence CATCACTTGGGGCTGTTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039916998 Original CRISPR CATCACTTGGGGCTGTTATC AGG (reversed) Intronic
900844986 1:5090732-5090754 CATCACTTGGGGGTGTTTGATGG - Intergenic
903569398 1:24293375-24293397 CATCCCATGGGGCTGTTGTGAGG + Intergenic
904485313 1:30820967-30820989 CATCTCATGGGGTTGTTATGAGG - Intergenic
906086325 1:43137866-43137888 GATCACTTGGGGATGTCAGCTGG - Intergenic
909562089 1:77018404-77018426 TATCACTTGGGGTTGTTGTGAGG - Intronic
912738205 1:112168839-112168861 TATCCCTTGGGGCTGTCATGAGG + Intergenic
918471914 1:184884075-184884097 CAGAACATGGGGCAGTTATCTGG - Intronic
921063552 1:211606870-211606892 CATCACTTGGAGATGTTGTAAGG - Intergenic
922856060 1:228775556-228775578 CATCTCTGGGGGCTGTTATTTGG + Intergenic
1063151852 10:3344321-3344343 CAGCACATGTGGCTGTTACCCGG + Intergenic
1063304917 10:4888533-4888555 CATCACTTCGGGCTCTTGTCTGG - Intergenic
1065318186 10:24484881-24484903 CCTGACTTGGGGCTGTTTCCTGG + Intronic
1073451254 10:103610761-103610783 CATCTCTTAGGGCTGTTGTAAGG - Intronic
1073739909 10:106394519-106394541 CAGCTCTTGGGTCTGTTCTCAGG - Intergenic
1073755137 10:106573177-106573199 CATCATTTGGTGCTGATATTTGG - Intergenic
1075730514 10:124632817-124632839 CATCACTCTGGGCTGTGCTCAGG + Intronic
1076096787 10:127739028-127739050 CAACACGTGGGGCTGTCACCAGG - Exonic
1081805435 11:45887420-45887442 CCTCTCTTGGGGCAGTTATGAGG - Intronic
1084582420 11:70032317-70032339 CATCACTGGGGTCTCTTTTCTGG - Intergenic
1085990100 11:81831056-81831078 CATCACAGGGGGCTGTAAACTGG + Intergenic
1088454949 11:110023931-110023953 CATCAGTTGGGACTATAATCAGG - Intergenic
1091312233 11:134582826-134582848 AGTCACATGGGGCTGTTTTCAGG - Intergenic
1098597628 12:72293094-72293116 CCTCAGCTGGGGCTGTCATCTGG + Intronic
1104095858 12:125557341-125557363 CATCTCTTGGGGTTGCTATAGGG + Intronic
1107352687 13:39532297-39532319 CATCAGTTGGGGCTGTTTTGTGG - Intronic
1113751700 13:112780998-112781020 CATCACACGGGGCTGTTTTCAGG - Intronic
1116668014 14:47802530-47802552 AATCATTTGAGGCTTTTATCTGG - Intergenic
1121248648 14:92483327-92483349 CATCCCATGGGGCTGTTATGAGG - Intronic
1123411479 15:20064424-20064446 CATGATTTGGGGATGTTTTCAGG - Intergenic
1123520829 15:21071543-21071565 CATGATTTGGGGATGTTTTCAGG - Intergenic
1124090297 15:26593076-26593098 CATCACCTGGGAATGTTATCTGG - Intronic
1124400775 15:29345652-29345674 AATCCCTGGGGGGTGTTATCAGG - Intronic
1125093769 15:35827460-35827482 GATCACTTGGGGTTGATACCTGG + Intergenic
1126501556 15:49351722-49351744 CATCCATTGGGACTGTTATCAGG - Intronic
1130073717 15:80670862-80670884 CCTCACTTGTGGGTCTTATCTGG - Intergenic
1134352507 16:13451091-13451113 CATCACTGAGGGCTGTTCCCGGG - Intergenic
1138649734 16:58452877-58452899 CATCACATGGGGCTGTTATGAGG + Intergenic
1150604013 17:66675805-66675827 CATCGCTAGGGGCTATTATGTGG - Intronic
1151328001 17:73390721-73390743 CTTCACTTGGGGCTGTTACGGGG - Intronic
1156324007 18:36056773-36056795 CATAACTTGTGGCTGTTCTAAGG - Intronic
1161479064 19:4501640-4501662 CATCACTGTGGGCTGCTGTCTGG + Intronic
1165621795 19:37254282-37254304 CATCACTGGGAACTGTTATTTGG - Intergenic
1165633380 19:37320415-37320437 CATCACTGGGAACTGTTATTTGG - Intronic
1166923534 19:46249536-46249558 AATCTCTTGGGGCTGTAATAAGG - Intergenic
931774661 2:65530304-65530326 CAGCACTGGGTGCTGTTAACAGG + Intergenic
934573730 2:95387536-95387558 CATCAGTTGGGGTTGTTGGCAGG + Intergenic
934588146 2:95524238-95524260 CAGCACTTGTTGCTGTTAACAGG + Intergenic
935658211 2:105443001-105443023 CAGGACTTGGGGCTGTGGTCAGG + Intergenic
937640733 2:124208179-124208201 TATCACGTGGGTTTGTTATCTGG + Intronic
939998568 2:148943667-148943689 CAGCACTTGGGGCAGCTATAAGG - Intronic
941449287 2:165640242-165640264 CATCACATAGTGCTGTTATGAGG - Intronic
942008960 2:171739145-171739167 CTTCATTTGGTGGTGTTATCAGG + Intronic
944902978 2:204234784-204234806 CATCACTTGGGGCTGGTAAGTGG - Intergenic
948174098 2:235929395-235929417 CATCACTGTGGGCTTTTTTCTGG + Intronic
948758930 2:240178477-240178499 CCTCTCTTGGGGCTGTTAGCCGG - Intergenic
1173386184 20:42590160-42590182 CCTCAACTGGGGCTGTTAGCTGG - Intronic
1174423675 20:50417022-50417044 CATCTCTTGGGGCTGTCAGGAGG - Intergenic
1175075864 20:56372500-56372522 CATTAGTGGGAGCTGTTATCTGG - Intronic
1175202637 20:57288767-57288789 AGTCACTTGGGGCTGTCTTCAGG - Intergenic
1177967987 21:27752354-27752376 CATCACTTAGGATTGTGATCAGG + Intergenic
1181010827 22:20039658-20039680 CATCACGTGGGGCTGTAAACAGG - Intronic
1183654129 22:39175313-39175335 AATCACTTTGGGCTGGTTTCGGG + Intergenic
1184245485 22:43233788-43233810 CATCACTGGGGGATGTTGCCTGG - Intronic
950569730 3:13792530-13792552 CATCACACGGGGCTGTTGTGAGG + Intergenic
955168567 3:56540259-56540281 TATCACTTAGGGCTGTTGTCAGG - Intergenic
955468513 3:59261723-59261745 AAACACTTGGGGCTGTTCTCTGG - Intergenic
955560993 3:60190597-60190619 CATCACTGGGGACTGTTGTGGGG + Intronic
960844942 3:121996490-121996512 CATCCCGTGAGGCTGTTTTCAGG - Intronic
962848975 3:139293808-139293830 CACAACATGGGGTTGTTATCAGG + Intronic
963734474 3:149004200-149004222 CATCACTAGCAGCTGTGATCCGG - Intronic
968526719 4:1061872-1061894 CATAATTTGGGGCTGCAATCTGG - Intronic
968640994 4:1714657-1714679 CATCACTGTGGTCTCTTATCTGG - Intergenic
969636833 4:8374237-8374259 CATCACTTAGGGTTTTTCTCAGG + Intronic
972091772 4:35295417-35295439 CACCAGTTGTTGCTGTTATCAGG + Intergenic
972195210 4:36645950-36645972 CATCACGTTGGGGTGTCATCAGG + Intergenic
975206300 4:71647662-71647684 CAGCTCTTGGGGCTGTTCTACGG - Intergenic
975360401 4:73462966-73462988 CATCAGATGGGGCTGCTAACTGG - Intergenic
987212734 5:15699826-15699848 CATCAATTAGGGCTGTGATCTGG - Intronic
991392988 5:66168921-66168943 CATCTCTTAGGGCTGTCATGAGG - Intronic
992774179 5:80075524-80075546 CATCATTTAGGGCAGTTGTCAGG - Intronic
993269136 5:85770670-85770692 CATCACTCGGGGCTTCTATTTGG + Intergenic
997816330 5:137022271-137022293 CATGAATTGGGGCTGTTGGCTGG - Intronic
999815857 5:155175285-155175307 CATCACTGGGGCCTGTTGTGGGG - Intergenic
1000165876 5:158648251-158648273 AATCCCTTGCTGCTGTTATCAGG + Intergenic
1000264043 5:159617685-159617707 CTTCACATGAGGCTGTTGTCAGG - Intergenic
1000917405 5:167099214-167099236 CATTACTTAGGGCTGTTTTAGGG + Intergenic
1001283706 5:170406904-170406926 CATCTCTTGGGGTTTTTATTTGG - Intronic
1002613278 5:180435363-180435385 CCCCACTTGGGGCTGGTTTCTGG + Intergenic
1006739191 6:36295164-36295186 CATCACTGGGGCGTGTGATCAGG + Intronic
1007748116 6:44055644-44055666 CATCACTTGGGGATGCTGGCGGG - Intergenic
1014863672 6:126502890-126502912 CATCATTTGGGGCTTTTGTGTGG + Intergenic
1021754997 7:23843186-23843208 TCTAACTTGGGGCTGTTAGCAGG - Intergenic
1024950697 7:54857619-54857641 CAGCACTTTGGGCTGTTTTTTGG + Intergenic
1025247458 7:57328062-57328084 CATCTCTTGGGGCTGTCAGGAGG + Intergenic
1027611003 7:80360454-80360476 CATGTCTTGGTGCTGTTTTCAGG + Intergenic
1027834433 7:83222266-83222288 CACCACTTTGTGCTGTCATCCGG - Intergenic
1034974680 7:155440978-155441000 CACCCCTTGGGGCTGTCATGAGG + Intergenic
1035587617 8:787837-787859 CAGCACTTGGGGCTGCTGTGAGG + Intergenic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1037460472 8:19103390-19103412 CTTCCCTTGGTGCTGTTCTCAGG - Intergenic
1039884056 8:41645589-41645611 CATCATTTGGTGCTGATATAAGG - Exonic
1039916998 8:41867482-41867504 CATCACTTGGGGCTGTTATCAGG - Intronic
1040017681 8:42713087-42713109 CAGCACTTTGGGCTGACATCAGG - Intronic
1042060887 8:64816107-64816129 CATCACTTACTACTGTTATCTGG + Intergenic
1044931095 8:97252335-97252357 CATCTTATGGGGCTGTTATAAGG - Intergenic
1056721363 9:89075060-89075082 CATCACCTGGGGCTGTGGGCAGG + Intronic
1058808379 9:108615376-108615398 AATCCCTTGGGGCTGATCTCTGG - Intergenic
1059696587 9:116735640-116735662 AATCAGTGGGGGCTGCTATCAGG + Intronic
1061127853 9:128688421-128688443 TATCGCTTGGGGCTGTTGTGAGG + Intronic
1188659883 X:32746117-32746139 CATGACTTGGTCCTGTTCTCTGG + Intronic
1189550648 X:42089023-42089045 CACCACCTGGGCCTTTTATCTGG + Intergenic
1190432159 X:50388484-50388506 CATCCTTTGGGGCTGTTCCCAGG - Intronic
1191029276 X:55950535-55950557 AATCATTGGGGGCTGTTATGAGG + Intergenic
1192661884 X:73050260-73050282 CCTCACTTGGGGCAGTTGCCAGG - Intergenic
1198094228 X:133362713-133362735 CATCACACAGGGCTGTTTTCAGG - Intronic
1199722298 X:150550711-150550733 CAACTCTGGGAGCTGTTATCGGG - Intergenic
1200854857 Y:7926514-7926536 CATTACTTGAGGCTGTAATCAGG - Intergenic