ID: 1039919842

View in Genome Browser
Species Human (GRCh38)
Location 8:41885616-41885638
Sequence CAGGCTAAACAAGCTGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039919835_1039919842 -1 Left 1039919835 8:41885594-41885616 CCTGTCCCTTCCCAAGGCTTCAC 0: 1
1: 0
2: 0
3: 26
4: 344
Right 1039919842 8:41885616-41885638 CAGGCTAAACAAGCTGTGGAAGG No data
1039919833_1039919842 9 Left 1039919833 8:41885584-41885606 CCATCACACACCTGTCCCTTCCC 0: 1
1: 1
2: 7
3: 79
4: 591
Right 1039919842 8:41885616-41885638 CAGGCTAAACAAGCTGTGGAAGG No data
1039919838_1039919842 -7 Left 1039919838 8:41885600-41885622 CCTTCCCAAGGCTTCACAGGCTA 0: 1
1: 0
2: 2
3: 19
4: 172
Right 1039919842 8:41885616-41885638 CAGGCTAAACAAGCTGTGGAAGG No data
1039919837_1039919842 -6 Left 1039919837 8:41885599-41885621 CCCTTCCCAAGGCTTCACAGGCT 0: 1
1: 0
2: 2
3: 31
4: 223
Right 1039919842 8:41885616-41885638 CAGGCTAAACAAGCTGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039919842 Original CRISPR CAGGCTAAACAAGCTGTGGA AGG Intronic
No off target data available for this crispr