ID: 1039920416

View in Genome Browser
Species Human (GRCh38)
Location 8:41890033-41890055
Sequence AATGGTATTGTGAAGTCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 168}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039920416_1039920421 0 Left 1039920416 8:41890033-41890055 CCTCAAGACTTCACAATACCATT 0: 1
1: 0
2: 0
3: 11
4: 168
Right 1039920421 8:41890056-41890078 GGAAGGCCAGGAATGAACTTTGG No data
1039920416_1039920423 6 Left 1039920416 8:41890033-41890055 CCTCAAGACTTCACAATACCATT 0: 1
1: 0
2: 0
3: 11
4: 168
Right 1039920423 8:41890062-41890084 CCAGGAATGAACTTTGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039920416 Original CRISPR AATGGTATTGTGAAGTCTTG AGG (reversed) Intronic
900922695 1:5683640-5683662 AATGGCATTGTGAAGGTGTGAGG - Intergenic
903491832 1:23734895-23734917 AATTTTATTGTAAAGTTTTGTGG - Intergenic
905233875 1:36532164-36532186 AATGCTAATGAGATGTCTTGTGG + Intergenic
905635692 1:39550205-39550227 AATGGTATTGTTGACTGTTGAGG + Intergenic
905881746 1:41468498-41468520 AATTGGACTGTGAACTCTTGAGG - Intergenic
907407391 1:54262032-54262054 AATGGGAATGTGATGTTTTGAGG - Intronic
908005996 1:59730118-59730140 AGTGGTAATTTGAAGTGTTGGGG - Intronic
910173442 1:84402335-84402357 AATTGTATATTGAAGTCTTCTGG + Intronic
911230202 1:95353104-95353126 AATGGTAATGTGAACTCTCTGGG + Intergenic
911869623 1:103078838-103078860 AATAGTATTGAAAAGTCTTCTGG + Exonic
911947648 1:104132972-104132994 AATGGTATTCTGAACACCTGGGG - Intergenic
915857255 1:159402359-159402381 AGTTGTCTTGTGAAGTCTTTAGG - Intergenic
917061294 1:171043858-171043880 AGTTTTCTTGTGAAGTCTTGAGG + Intronic
918902249 1:190438021-190438043 GATTTTATTGTGAAATCTTGAGG - Intronic
919575491 1:199303614-199303636 TATGGCATGTTGAAGTCTTGCGG - Intergenic
922137352 1:222842721-222842743 AATGGTACTAAGAAGTCCTGTGG + Intergenic
922291368 1:224211504-224211526 AAGGGCATTTTGAAGTCTGGAGG - Intergenic
924712458 1:246541101-246541123 AAAAGTGTTTTGAAGTCTTGAGG + Exonic
1065250146 10:23802718-23802740 AAAGGTAATGTGAAGTCATTGGG + Intronic
1065767482 10:29044403-29044425 AATGGTATAATGAATTCTTGTGG - Intergenic
1068428144 10:56894406-56894428 ATTGGTATTGTTATGTCTTTTGG + Intergenic
1070851491 10:79566203-79566225 AGTGTTTTTGTGAAGTCTTTAGG + Intergenic
1079615326 11:22485546-22485568 AAAGGGATTGTGAAGACTTTTGG + Intergenic
1079675001 11:23215961-23215983 AATAGAATTGTTGAGTCTTGAGG + Intergenic
1079740713 11:24056178-24056200 AATGGCATTTTGAAAGCTTGGGG + Intergenic
1080137806 11:28877703-28877725 AATTTTATTGTGAAATTTTGTGG + Intergenic
1080608828 11:33886577-33886599 AATGTTATTGTGAAACCTTTAGG - Intronic
1083385210 11:62303458-62303480 AATGGTAGTTTGAAGTTCTGTGG + Intergenic
1085974752 11:81638754-81638776 AATGGTATTGTGCTTTCTTTGGG + Intergenic
1086426718 11:86691793-86691815 AGTGATTTTGGGAAGTCTTGTGG + Intergenic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1089550508 11:119272529-119272551 AGTGGAATTGCTAAGTCTTGGGG + Intronic
1089942485 11:122433322-122433344 AATGGTATTTGGAGGTCTTTGGG + Intergenic
1093134351 12:15432522-15432544 AATGGGATTGTGGAGTCAAGTGG + Intronic
1093383513 12:18522689-18522711 AATTGGAGTGTGATGTCTTGGGG + Intronic
1093899221 12:24610829-24610851 AATGGTATTTTTCAGTATTGTGG + Intergenic
1095374430 12:41509162-41509184 AAAGGTATTTTGAAACCTTGTGG + Intronic
1095398403 12:41787397-41787419 CATGGTATGCTGAAGTTTTGAGG + Intergenic
1096605060 12:52758972-52758994 ACTGGTGTTCTGAAGTCTTCTGG - Intergenic
1100120427 12:91363471-91363493 AATAGTATTGAGAACTTTTGAGG - Intergenic
1103637375 12:122318594-122318616 AATGGTTATGTGAAGTCCTGTGG - Intronic
1105238213 13:18582272-18582294 AATGCTGTGGTGAGGTCTTGTGG - Intergenic
1111193665 13:84843021-84843043 TATGGTATTGTGCAGGCTTTAGG + Intergenic
1113108480 13:106796983-106797005 AATGGTATTGTGAGAGATTGGGG - Intergenic
1114827037 14:26093579-26093601 AATCACATTGTGAAGTCCTGGGG + Intergenic
1117874905 14:60242249-60242271 AAGGAAATTGAGAAGTCTTGAGG - Intergenic
1118070072 14:62236627-62236649 AATGGTATTCTGCAATTTTGGGG + Intergenic
1118813643 14:69293403-69293425 AATTGTATTTTGAAGTGTTTGGG - Intronic
1120230723 14:81837796-81837818 AATGGTATTATGAAAACTAGTGG + Intergenic
1123186783 14:106525704-106525726 AATGTTATTTTGGAGACTTGTGG + Intergenic
1124031063 15:26012304-26012326 AATGATGTTGTGAAGACTTCTGG - Intergenic
1125982160 15:44012588-44012610 TACGGTATTGAGAAGTGTTGTGG + Intronic
1127605812 15:60587158-60587180 CATGGTATTCTGTATTCTTGGGG + Intronic
1127979249 15:64022517-64022539 CATGGGATTGTGAACTCTTTAGG - Intronic
1129341478 15:74889393-74889415 ATTGCTATTGTGAAGACTTTGGG - Intergenic
1130098048 15:80870767-80870789 CTTGTTATTGTGAAGACTTGTGG + Intronic
1130717311 15:86347908-86347930 AAAGGAATTATGAAGTCTTGAGG - Intronic
1132921551 16:2398160-2398182 ACTGGAAGTGAGAAGTCTTGTGG - Intergenic
1134321128 16:13164822-13164844 AACTCTATTGTGAAATCTTGTGG - Intronic
1135388003 16:22061448-22061470 AAGGGAATTGTGCAGTCGTGTGG - Intronic
1137294945 16:47083189-47083211 AATGGTGATGTGAATTCTTAGGG - Exonic
1137960860 16:52880829-52880851 ATTTGTAATTTGAAGTCTTGGGG - Intergenic
1138319629 16:56101071-56101093 AAAAGTTTTGTGAAGTCTGGAGG - Intergenic
1141052804 16:80787260-80787282 AATGGAACTGAGAGGTCTTGGGG + Intronic
1141659055 16:85431816-85431838 AATGGGATTGGGAAGGCTGGAGG - Intergenic
1143186646 17:5014125-5014147 GCTGGTATTATGAAGTCATGGGG + Intronic
1151130338 17:71890173-71890195 AATCGTATTGTCATGTTTTGCGG - Intergenic
1153106848 18:1537531-1537553 AGTGGTATTGTGAGATCATGTGG + Intergenic
1158881885 18:61787609-61787631 AATGGTATTGTTGGATCTTGTGG + Intergenic
1159062261 18:63528348-63528370 AATGGGATTCTCAAATCTTGAGG - Intergenic
1166008349 19:39923244-39923266 AATGACATGGTGAAGTCTTTTGG + Intronic
1166233642 19:41440706-41440728 AGAGCCATTGTGAAGTCTTGTGG + Intronic
1167359311 19:49021505-49021527 AGGGCTATTGTGAAGTCCTGTGG + Intergenic
1167359324 19:49021639-49021661 AGGGCTATTGTGAAGTCCTGTGG + Intergenic
926621985 2:15054966-15054988 AAAGGCATTTTAAAGTCTTGTGG + Intergenic
928076403 2:28268845-28268867 AATCCTAGTATGAAGTCTTGAGG + Intronic
928389736 2:30899940-30899962 AAGGGTATGGTGAAGTTTTGTGG - Intergenic
930219762 2:48734639-48734661 AATAGTTTTGTGAACTATTGTGG + Intronic
931017968 2:58007639-58007661 TATGTTATTGTGAAGGCTTCTGG + Intronic
932681700 2:73831133-73831155 GATGATATTGTGAAGTTCTGTGG - Intronic
933407180 2:81875585-81875607 AAATGTATTGTGAATTCTTTTGG + Intergenic
936916844 2:117648765-117648787 AATGGTATTATGAAAGCATGAGG - Intergenic
937617992 2:123949383-123949405 AATTTTCTTGTGAAGTCTTTAGG - Intergenic
938625716 2:133106642-133106664 AATGCTATTGGGAAGTGGTGAGG + Intronic
940722786 2:157299866-157299888 AATGGTGTTGTGAAATATTAGGG - Intronic
940840575 2:158575648-158575670 GAAGGTATTGTGATGGCTTGGGG + Intronic
944289183 2:197985813-197985835 ATTGATATTATGAAGTGTTGTGG + Intronic
945884142 2:215356953-215356975 AATGGAACTGTGAAGTCGTATGG + Intergenic
947084943 2:226440347-226440369 ATTGTTTTTGTGAAATCTTGTGG - Intergenic
947364003 2:229375415-229375437 AATGCTGTTGTGGAGTTTTGTGG - Intronic
1169322144 20:4641819-4641841 GATGGTATGGTGATGTGTTGGGG - Intergenic
1173409231 20:42794842-42794864 AATGCTAGTGTAAGGTCTTGGGG + Intronic
1182953509 22:34399280-34399302 AATGGTTTTGTGATTTCTCGTGG + Intergenic
951648155 3:24917103-24917125 AATTTTATAATGAAGTCTTGGGG + Intergenic
951809314 3:26682211-26682233 AAAGCTATTGGCAAGTCTTGTGG - Intronic
952698565 3:36299511-36299533 AAAGGTTTTGAGGAGTCTTGGGG + Intergenic
954839734 3:53499877-53499899 AAGGGAATTCTGAAGTCTTAAGG + Intronic
955130701 3:56164539-56164561 AATGGTAGCGTGAACACTTGTGG + Intronic
955378737 3:58419707-58419729 AATGGTACTGAGAAGGCTGGAGG + Intronic
955501924 3:59593970-59593992 AATGATATTGTGAGGGATTGAGG - Intergenic
955890186 3:63641873-63641895 AATGGTATTTTTAATTTTTGAGG - Intergenic
957175225 3:76799474-76799496 AATATTTTTGTGAAGTCTTTAGG - Intronic
958080965 3:88745683-88745705 AATGAAATTTTGAATTCTTGTGG - Intergenic
958652251 3:96952325-96952347 AATGGTATTGTGAGGTGGTAGGG + Intronic
959498176 3:107075183-107075205 ATTGGTTTCGTGTAGTCTTGTGG - Intergenic
959621329 3:108401189-108401211 AGTCATATTCTGAAGTCTTGGGG - Intronic
961594713 3:128007054-128007076 ACTGGTATTGGGATGTCTGGGGG - Intergenic
962377877 3:134873885-134873907 AATCCTATTGTGAGGTCATGGGG + Intronic
964235030 3:154515568-154515590 AATTTTTTTGTGAAGTCTTTAGG + Intergenic
964376069 3:156050288-156050310 AATGAAAGTGTGAAGTCTTGGGG + Intronic
966487096 3:180483503-180483525 AATGCTAATGGGAAGTCTGGAGG + Intergenic
967020031 3:185514774-185514796 CCAGGTATTGTGAAGTCTTAGGG + Intronic
972811234 4:42588094-42588116 ACTGGTATTGTTAAGTATTATGG - Intronic
974554560 4:63427958-63427980 AATGGTATAAGGAAGTGTTGTGG + Intergenic
975227259 4:71888455-71888477 AACGGTATTTTGCAGTCTTTAGG - Intergenic
979225173 4:118276718-118276740 AATTATATTCTCAAGTCTTGAGG + Intergenic
979355112 4:119694345-119694367 AAAAGTATTATGAAATCTTGTGG - Intergenic
980283171 4:130747886-130747908 AATGGCAATGTGAATTTTTGTGG + Intergenic
984446219 4:179839733-179839755 CATGGTACTGTGAAGGCATGTGG - Intergenic
985350022 4:189050080-189050102 AATCATATTCTAAAGTCTTGTGG - Intergenic
987168600 5:15227889-15227911 AGTTGTGTTGTGAAGTCTTTAGG + Intergenic
988833530 5:35009634-35009656 AATGTTATGGTGAAGGTTTGGGG - Intronic
989806745 5:45617597-45617619 AATGGTATGGTGAACTCTAGAGG + Intronic
992408236 5:76479815-76479837 AATGATATTCAGAAGTCTTGTGG + Intronic
993408806 5:87548405-87548427 AATTTTATGGTGAAGTCTTTAGG + Intergenic
994672379 5:102778019-102778041 AATGGCATTGTGCCGTCTTGGGG + Intronic
996298100 5:121948005-121948027 AATGGAATTGGGAAGCCATGGGG - Intergenic
1000790950 5:165606571-165606593 AATGGAATAGAGAAGTCTTAAGG - Intergenic
1001285773 5:170422748-170422770 AAAGGTACTGAGAAGTCTTGTGG - Intronic
1001977994 5:176016331-176016353 AATGCTATTGTGTACACTTGAGG - Intronic
1002239425 5:177827431-177827453 AATGCTATTGTGTACACTTGAGG + Intergenic
1003322649 6:5065863-5065885 AAAAGTTTTTTGAAGTCTTGAGG + Intergenic
1005015841 6:21374805-21374827 AAATCTATTGTGAAGACTTGTGG + Intergenic
1005222697 6:23606211-23606233 AATGGTATTGAGAGGTGGTGAGG - Intergenic
1005358957 6:25012421-25012443 AATGGCACTGTGAACACTTGTGG - Intronic
1007806990 6:44457869-44457891 AATTGTATTGGGAAGGCATGGGG - Intergenic
1009052307 6:58290921-58290943 AATTGTTTTCTTAAGTCTTGTGG + Intergenic
1009238801 6:61159693-61159715 AATTGTTTTCTTAAGTCTTGTGG - Intergenic
1010395251 6:75384664-75384686 AATAGCATTGGGAAGTCTTCAGG + Intronic
1010871067 6:81040433-81040455 TAAGGTTTTGTGGAGTCTTGAGG + Intergenic
1012291395 6:97459749-97459771 AATCATTTTGTGAAGTGTTGGGG + Intergenic
1012637719 6:101565814-101565836 CATGTTATTGTTAAGTCTTCTGG - Intronic
1014294895 6:119606050-119606072 AATGGTTTCCTGAAGTCTGGAGG + Intergenic
1014828752 6:126076589-126076611 GATGGTGTTTTGAAGTTTTGTGG - Intergenic
1016429482 6:143967660-143967682 AATGGTATAATGAAGTGATGAGG + Intronic
1018162430 6:161058968-161058990 AATGGAATTGTTAGGTCATGGGG + Intronic
1018776318 6:167019832-167019854 ATTGGCAGTGTGAATTCTTGGGG + Intronic
1020427053 7:8078907-8078929 AATGGTATTATAATGTCTTTAGG - Intronic
1020463565 7:8450794-8450816 AATGGCATTTTGAATTCTTGCGG - Intronic
1022769470 7:33453900-33453922 TATGTTATTGGGAAGTCTTCAGG + Intronic
1024708644 7:51989749-51989771 AATGGGATTGCTGAGTCTTGTGG + Intergenic
1028305498 7:89258681-89258703 TATGTTATTGTTAAGGCTTGTGG - Intronic
1028381849 7:90208861-90208883 AATGATATAGTGGAGTCTGGGGG - Intronic
1030249342 7:107424995-107425017 AATGGTTTTGAGGAGTATTGTGG - Intronic
1031817023 7:126450588-126450610 AATGGTATTTTGAAGTCCATTGG - Intronic
1031895172 7:127340046-127340068 AATGGCACTGGGAAGTCTTGGGG - Intergenic
1033867250 7:145705839-145705861 AATGATATTTTAAAGTCTTTTGG + Intergenic
1034130585 7:148712485-148712507 AAAGGTATTGTGGAGTTTTCAGG + Intronic
1039920416 8:41890033-41890055 AATGGTATTGTGAAGTCTTGAGG - Intronic
1040394403 8:46982691-46982713 ATTGGAATTGTGGGGTCTTGAGG + Intergenic
1043839603 8:85086957-85086979 ATTGGAATTCTGAAGGCTTGAGG + Intergenic
1048921292 8:139232434-139232456 AATGGTAATGTGATTTCTCGAGG + Intergenic
1050715643 9:8522100-8522122 AGTGTTAGTGTGAGGTCTTGAGG - Intronic
1052471082 9:28898450-28898472 AATAGTGCTGTGAAGTTTTGTGG - Intergenic
1053584661 9:39444496-39444518 AATGGATTTGGGAAGTCCTGAGG - Intergenic
1054106241 9:61003242-61003264 AATGGATTTGGGAAGTCCTGAGG - Intergenic
1054581656 9:66920726-66920748 AATGGATTTGGGAAGTCCTGAGG + Exonic
1055546310 9:77377617-77377639 AATGGTTTTGTGGATTCTTTTGG + Intronic
1057430975 9:94993767-94993789 AACTGAATTGTGAAGTCTTCTGG - Intronic
1058983019 9:110187674-110187696 AATGGAATTGTGAGGTCATATGG + Intergenic
1059016363 9:110520506-110520528 ACTGGAAGTGTGAATTCTTGAGG + Intronic
1061145674 9:128796961-128796983 AATGCTTTTGGGGAGTCTTGGGG + Intronic
1061979377 9:134091939-134091961 AATTGTTTTGTGGAGTCTTCAGG + Intergenic
1185998726 X:4984778-4984800 AATGTTATTTTCAAGTCTTTGGG + Intergenic
1187358429 X:18601035-18601057 AATGGTCCTGAGAAGTCTTAGGG - Intronic
1188802830 X:34552399-34552421 AATGGGACTGTGAATTGTTGGGG + Intergenic
1193767768 X:85551649-85551671 AATTATATTTTGAAGTTTTGAGG + Intergenic
1197267336 X:124388996-124389018 AATTATATTTTGAAGACTTGTGG - Intronic
1199545895 X:149007143-149007165 ATTGTTATTTTGAAATCTTGTGG + Intergenic
1200228109 X:154430527-154430549 CCAGGTATTGTGAAGTGTTGGGG + Intronic