ID: 1039923022

View in Genome Browser
Species Human (GRCh38)
Location 8:41906463-41906485
Sequence GAGTAAAGAGTCCCTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039923013_1039923022 -7 Left 1039923013 8:41906447-41906469 CCTCTCCCCGCCAATAGAGTAAA No data
Right 1039923022 8:41906463-41906485 GAGTAAAGAGTCCCTGGGGTGGG No data
1039923011_1039923022 21 Left 1039923011 8:41906419-41906441 CCTGAATTAAGCCTTCAGCAACA No data
Right 1039923022 8:41906463-41906485 GAGTAAAGAGTCCCTGGGGTGGG No data
1039923010_1039923022 22 Left 1039923010 8:41906418-41906440 CCCTGAATTAAGCCTTCAGCAAC No data
Right 1039923022 8:41906463-41906485 GAGTAAAGAGTCCCTGGGGTGGG No data
1039923009_1039923022 23 Left 1039923009 8:41906417-41906439 CCCCTGAATTAAGCCTTCAGCAA No data
Right 1039923022 8:41906463-41906485 GAGTAAAGAGTCCCTGGGGTGGG No data
1039923012_1039923022 10 Left 1039923012 8:41906430-41906452 CCTTCAGCAACAAGCTTCCTCTC No data
Right 1039923022 8:41906463-41906485 GAGTAAAGAGTCCCTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039923022 Original CRISPR GAGTAAAGAGTCCCTGGGGT GGG Intergenic
No off target data available for this crispr