ID: 1039923714

View in Genome Browser
Species Human (GRCh38)
Location 8:41910567-41910589
Sequence GTCAGCACACGGATGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039923714_1039923724 26 Left 1039923714 8:41910567-41910589 CCATCCTTCATCCGTGTGCTGAC No data
Right 1039923724 8:41910616-41910638 GCACAGAAACGTGTCGGGGGTGG No data
1039923714_1039923722 22 Left 1039923714 8:41910567-41910589 CCATCCTTCATCCGTGTGCTGAC No data
Right 1039923722 8:41910612-41910634 CGGTGCACAGAAACGTGTCGGGG No data
1039923714_1039923727 29 Left 1039923714 8:41910567-41910589 CCATCCTTCATCCGTGTGCTGAC No data
Right 1039923727 8:41910619-41910641 CAGAAACGTGTCGGGGGTGGGGG No data
1039923714_1039923721 21 Left 1039923714 8:41910567-41910589 CCATCCTTCATCCGTGTGCTGAC No data
Right 1039923721 8:41910611-41910633 CCGGTGCACAGAAACGTGTCGGG No data
1039923714_1039923726 28 Left 1039923714 8:41910567-41910589 CCATCCTTCATCCGTGTGCTGAC No data
Right 1039923726 8:41910618-41910640 ACAGAAACGTGTCGGGGGTGGGG No data
1039923714_1039923725 27 Left 1039923714 8:41910567-41910589 CCATCCTTCATCCGTGTGCTGAC No data
Right 1039923725 8:41910617-41910639 CACAGAAACGTGTCGGGGGTGGG No data
1039923714_1039923719 20 Left 1039923714 8:41910567-41910589 CCATCCTTCATCCGTGTGCTGAC No data
Right 1039923719 8:41910610-41910632 CCCGGTGCACAGAAACGTGTCGG No data
1039923714_1039923717 2 Left 1039923714 8:41910567-41910589 CCATCCTTCATCCGTGTGCTGAC No data
Right 1039923717 8:41910592-41910614 AACACATCTGTTGCATAGCCCGG No data
1039923714_1039923723 23 Left 1039923714 8:41910567-41910589 CCATCCTTCATCCGTGTGCTGAC No data
Right 1039923723 8:41910613-41910635 GGTGCACAGAAACGTGTCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039923714 Original CRISPR GTCAGCACACGGATGAAGGA TGG (reversed) Intergenic
No off target data available for this crispr