ID: 1039925970

View in Genome Browser
Species Human (GRCh38)
Location 8:41932764-41932786
Sequence GTGGATGCCAAGTTTGGGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039925970 Original CRISPR GTGGATGCCAAGTTTGGGGG TGG Exonic
900377099 1:2359942-2359964 GTGGATGCCGAGCTTTGGGACGG + Intronic
900797890 1:4720371-4720393 GGGGAAGCCAAGTTTGTTGGAGG + Intronic
901219435 1:7574808-7574830 GTGGAAGCCAAGTTGGCTGGAGG - Intronic
903499110 1:23792039-23792061 GTGGAGCACCAGTTTGGGGGTGG + Intronic
904311342 1:29631610-29631632 GGAGATGCCAAGTATGGGAGAGG + Intergenic
904521297 1:31098208-31098230 TGGGAGGCCAAGGTTGGGGGGGG - Intergenic
905248723 1:36633086-36633108 GTGGTTGCCAAGGTTTGGGTAGG - Intergenic
905909824 1:41646108-41646130 GGGGATGCCAAGGTTGGGAGAGG + Intronic
906021664 1:42634860-42634882 GTGGTTGCCTAGTCTGGTGGTGG - Intronic
906386961 1:45378058-45378080 ATGGATGGCCAGTTTGGGGAAGG + Intronic
906439962 1:45832960-45832982 GTGGTTGCCTAGTGTGGGGGCGG - Intronic
906538056 1:46562846-46562868 GTGGGGGCCAGGGTTGGGGGAGG + Intronic
908288966 1:62641712-62641734 GTGGCTGCCAAAGTTGGGAGGGG - Intronic
910763354 1:90756964-90756986 ATGGTTGCCAGGTCTGGGGGAGG - Intergenic
911388271 1:97205072-97205094 GAAGGTGCCGAGTTTGGGGGTGG - Intronic
912707974 1:111928969-111928991 TTGGATTCCAAGTTTGCAGGAGG - Intronic
912870829 1:113303917-113303939 GTGGTTGCCAGGGTTTGGGGAGG + Intergenic
913165655 1:116182218-116182240 GTGGATGGCAAGCATGGGAGTGG + Intergenic
913256302 1:116957053-116957075 GTGGTTGAAAAGTTTGGAGGTGG + Intronic
915079888 1:153344906-153344928 GTGCAAGCCAGGGTTGGGGGAGG + Intronic
915729969 1:158046351-158046373 GAGAAGACCAAGTTTGGGGGTGG + Intronic
918371180 1:183863112-183863134 GAGGATGCCCAGTGTGTGGGTGG + Intronic
918480549 1:184973490-184973512 GTTGAAGGCAAGTTTGGGGTGGG + Intronic
919664656 1:200280321-200280343 GTGGATGCCAAGGGCTGGGGAGG - Intergenic
921121726 1:212143263-212143285 GTTGCTACTAAGTTTGGGGGTGG - Intergenic
921671597 1:217930281-217930303 ATGGAAGCCAATGTTGGGGGTGG - Intergenic
921861682 1:220047813-220047835 GTGGACTCCATGATTGGGGGCGG - Intergenic
922985417 1:229862577-229862599 GTGGCTGCCAGGGTTGTGGGAGG - Intergenic
923264651 1:232302573-232302595 GTGGAAGGCAAGTATGGGGGAGG + Intergenic
923377510 1:233379332-233379354 GTGGATGGCAGGCTTGTGGGAGG - Exonic
1063156979 10:3388999-3389021 GTGGATGCAGAGTCTGGGGTGGG + Intergenic
1063378631 10:5570301-5570323 GTGGATGCCAAGTCTGTGCCTGG - Intergenic
1065185673 10:23168859-23168881 GTGGATGCAAGATTTGGGGTCGG - Intergenic
1067341793 10:45411792-45411814 GTGGATGTCCAGGTTGGGCGTGG + Intronic
1067901360 10:50244880-50244902 GTGAATGCTCAGTTTGGGGGTGG - Intronic
1068836272 10:61557651-61557673 GTGGTTGCCAAGGTTGAGGTGGG + Intergenic
1069167631 10:65182687-65182709 GTGGTTGCCAGGATTGGGGAGGG - Intergenic
1069711471 10:70491758-70491780 ATGGTTGCCAAGGCTGGGGGAGG - Intronic
1069839011 10:71327713-71327735 GTGGAGTCAAAGTGTGGGGGTGG - Intronic
1070144884 10:73766556-73766578 GTGGAGGTAAAGGTTGGGGGTGG + Intronic
1073989695 10:109248417-109248439 GTGGATGACAAGGTAGGAGGTGG - Intergenic
1074678732 10:115881879-115881901 GTGGAGGGCAAGTGTGGGGTTGG - Intronic
1075513960 10:123094711-123094733 GAGGAGGCCAAGTTTGGGTCGGG + Intergenic
1076317633 10:129553795-129553817 ATGGAGGCCACGTTTGGGGCAGG - Intronic
1076615108 10:131749880-131749902 GTGGATGCCCAGCTGTGGGGAGG - Intergenic
1076683921 10:132188138-132188160 GTGGGGGTCGAGTTTGGGGGTGG + Intronic
1077287059 11:1772198-1772220 GTGGTTGCCAGGGTTTGGGGAGG + Intergenic
1077317273 11:1925168-1925190 GTGGAGGTCAACTTTGGGTGGGG - Intronic
1077437744 11:2550867-2550889 GAGGCTGCCAAGTGAGGGGGGGG + Intronic
1077595403 11:3527438-3527460 GTGGATGCCAAGCAGGGGTGGGG + Intergenic
1078616045 11:12867321-12867343 GTGGATGCCAAGTGAAGGGCTGG - Intronic
1079956336 11:26870151-26870173 GTGGAAGCCAAGTTTAGTTGGGG + Intergenic
1080313465 11:30921890-30921912 GTGGATGCCAAGCAGGGGTGAGG + Intronic
1080984830 11:37449910-37449932 GAGGATGCCCAGGCTGGGGGTGG + Intergenic
1082020189 11:47526196-47526218 GTGCATGCCAGGTGTGGGGGTGG + Intronic
1083155780 11:60822013-60822035 GTGGCTGGCAGGTTGGGGGGCGG + Intergenic
1084167530 11:67382805-67382827 GTGGATGCTGAGTATTGGGGAGG + Intronic
1084697980 11:70767680-70767702 GTGGCTGCCAGGGGTGGGGGGGG + Intronic
1087120257 11:94567240-94567262 GATAATGCCAAATTTGGGGGTGG + Intronic
1088254714 11:107892314-107892336 GTGGTTGCCAGGGGTGGGGGTGG - Intronic
1088815804 11:113419995-113420017 CTGGATGCCCATTTTGCGGGTGG + Intronic
1089647209 11:119888189-119888211 GTGGAGGCCATGTTCGGGGTCGG + Intergenic
1089789173 11:120929988-120930010 GGGCAGGCCACGTTTGGGGGGGG + Intronic
1090957009 11:131522168-131522190 GGGGATGCTAAGTCTGGGAGGGG - Intronic
1095331557 12:40971377-40971399 GTGGATGCCCAATTAGGGGCAGG - Intronic
1095915255 12:47471685-47471707 GTATATGCCAAGTGAGGGGGGGG - Intergenic
1095971015 12:47902049-47902071 GGGGATGATAAGGTTGGGGGAGG - Intronic
1096255432 12:50059245-50059267 GTGAGTGGCAGGTTTGGGGGTGG - Intronic
1096477288 12:51915984-51916006 CTGGATCCCAGGTTTGGGAGAGG + Intronic
1096562067 12:52442866-52442888 GTAGATGCCTAGTTTAGGCGAGG + Intergenic
1098360303 12:69648094-69648116 GGCGATGCCAAGCTTGGGGTTGG + Intronic
1099511332 12:83542528-83542550 GTGGTTGCCAGGGGTGGGGGTGG + Intergenic
1101766048 12:107700353-107700375 GTGGTTGCCAGGGCTGGGGGTGG - Intronic
1102424106 12:112827217-112827239 GTGGTTGCCCAGGCTGGGGGAGG - Intronic
1102508250 12:113397504-113397526 CTAGAAGCCAAGGTTGGGGGTGG - Intronic
1103502160 12:121411350-121411372 GTAGATACCAATTTTGGAGGGGG - Intronic
1104833416 12:131770855-131770877 GTGGGTGCCAGGGCTGGGGGAGG - Intronic
1105547767 13:21364349-21364371 GTGGTTGCCAAAGGTGGGGGCGG - Intergenic
1106578963 13:31001259-31001281 CTGGCTGCCAAGGTTGGGTGGGG - Intergenic
1112495345 13:99899500-99899522 GTGGTTGTCAGGGTTGGGGGTGG + Intergenic
1113966346 13:114155670-114155692 GTGGGTGCTGAGTGTGGGGGTGG + Intergenic
1113966421 13:114155846-114155868 GTGGGTGCCAAGCCTGGGGGTGG + Intergenic
1113966482 13:114155987-114156009 GTGGGTGCCAGGCGTGGGGGTGG + Intergenic
1113966527 13:114156096-114156118 GTGGATGCCAGATGTGAGGGTGG + Intergenic
1114458432 14:22872142-22872164 CTGGATGCCAGGGCTGGGGGCGG - Exonic
1115165738 14:30447063-30447085 TTGGACCCCAAGTTTAGGGGTGG - Intergenic
1115330343 14:32190290-32190312 GTGATTGCCAAGGTTGGTGGGGG - Intergenic
1115691402 14:35847727-35847749 GTGGTTGCCAGGTGTGGCGGAGG - Intronic
1116244801 14:42395888-42395910 GTGTTTGCCAATTTTGGGGTTGG - Intergenic
1117410429 14:55445939-55445961 TGGGAGGCCAAGGTTGGGGGGGG - Intronic
1122340760 14:101027047-101027069 CTGAATGTCAAGTTTGGGGAAGG + Intergenic
1122836510 14:104433438-104433460 GTGGATGCCGTGATTGGAGGGGG - Intergenic
1122922841 14:104887036-104887058 GTGGATGCCGAGTGTGAGGGGGG + Exonic
1123020414 14:105395400-105395422 GTGCTTGCTAAGTTTGGGGCAGG - Exonic
1124346269 15:28923551-28923573 GTGGGTGCTGAGTCTGGGGGAGG + Intronic
1127738106 15:61866174-61866196 GTGGATGTCAAGTGTGGGCATGG - Intronic
1127841887 15:62838949-62838971 GTGAAAACCAAGTTTGTGGGGGG + Exonic
1128657220 15:69471128-69471150 GTGGTTGCCAGGGTTGGGGGAGG - Intergenic
1129205553 15:74035312-74035334 GGGGAGGCCAAGCTGGGGGGTGG - Intronic
1131003535 15:88957116-88957138 GCAGATGCCAAGCTTGGGGCTGG - Intergenic
1133227410 16:4348386-4348408 GTGAATGCCAAGCTGGGGAGTGG - Intronic
1133906468 16:10027194-10027216 GTGGATGCTAGGTGTTGGGGAGG - Intronic
1134680322 16:16120480-16120502 CTGAATGCCCAGGTTGGGGGAGG + Intronic
1134808717 16:17148285-17148307 GAGGATGCCAGGCATGGGGGAGG - Intronic
1135327732 16:21537983-21538005 GTGGGTGCCAGGCCTGGGGGAGG - Intergenic
1136073792 16:27804799-27804821 GTGGAGGCTGAGATTGGGGGCGG + Intronic
1136338084 16:29624003-29624025 GTGGGTGCCAGGCCTGGGGGAGG - Intergenic
1136453688 16:30369171-30369193 GGGGAAGCAAAGGTTGGGGGAGG - Intronic
1137597744 16:49736054-49736076 CTGTATGCCAGGGTTGGGGGAGG - Intronic
1137627212 16:49916735-49916757 GTGGATGCCTAGACTGGAGGGGG - Intergenic
1137707283 16:50544406-50544428 CTGGAAGCCTAGTTTGGGTGAGG - Intergenic
1140601735 16:76484566-76484588 GAGGAAGCCAAGAATGGGGGAGG + Intronic
1141182433 16:81763424-81763446 GTGGATGCCAACTTGGGCTGGGG + Intronic
1144371430 17:14595191-14595213 GTGGTTGCCAGGACTGGGGGAGG + Intergenic
1144611528 17:16722689-16722711 GTGGTTGCCAAGAGTTGGGGAGG - Intronic
1144901212 17:18592661-18592683 GTGGTTGCCAAGAGTTGGGGAGG + Intergenic
1145131294 17:20353436-20353458 GTGGTTGCCAAGAGTTGGGGAGG - Intergenic
1146641494 17:34545177-34545199 GTGGATACCAGGGCTGGGGGAGG + Intergenic
1147142122 17:38465848-38465870 GTGGAGGCCAGGACTGGGGGAGG + Intronic
1147248031 17:39134927-39134949 GTGGCTGCCAAGGCTGGAGGTGG - Intronic
1148605072 17:48922992-48923014 GTCGATGCCACGCTTGTGGGGGG - Intronic
1148713851 17:49701480-49701502 CTTGATGCCAAGTTTGGGAAAGG - Exonic
1148750060 17:49940464-49940486 GAGGCAGCCAAGGTTGGGGGTGG + Intergenic
1151927082 17:77205895-77205917 GTTGATGGCAGGTTGGGGGGTGG + Intronic
1152256438 17:79242750-79242772 GTGGAGGCCCAGTAAGGGGGTGG - Intronic
1153709387 18:7782600-7782622 GTGGTTGCCAGGGCTGGGGGAGG - Intronic
1156498703 18:37543345-37543367 GAAGATGCCCAGCTTGGGGGAGG - Intronic
1158445882 18:57520054-57520076 GTAGATGCCACTTTTGGGGTAGG - Intergenic
1159938680 18:74388938-74388960 GAGGAAGCCAAGGTTGGGGTTGG + Intergenic
1160024017 18:75204371-75204393 GCAGAGGCCAAGTTTGGGAGGGG + Intronic
1160202699 18:76808654-76808676 GTGGTTGCCATGCTTGAGGGAGG + Intronic
1160978924 19:1807546-1807568 GTGGCGGCCAAGCTTGGGGCTGG - Intronic
1161006898 19:1941498-1941520 GTGGACACCGAGTGTGGGGGCGG - Intronic
1161148957 19:2696786-2696808 GTGGGTGCCAGGGCTGGGGGAGG + Intronic
1161706971 19:5826740-5826762 GGGGCTTCCGAGTTTGGGGGTGG + Intronic
1163415060 19:17181302-17181324 GAGGATGGCACGTTTGCGGGTGG - Intronic
1163443399 19:17333177-17333199 GTGAAGGCCGAGTTTGGCGGGGG - Exonic
1163489581 19:17609401-17609423 ATGGATCCCAGGCTTGGGGGTGG - Intronic
1163632584 19:18424934-18424956 GGGAATCCCAAGTTTGGGGAAGG + Intronic
1165073383 19:33268226-33268248 GTTGTTACCAAGTTTGGGTGAGG + Intergenic
1165120559 19:33556131-33556153 CTGGAGGCCAAGGGTGGGGGTGG - Intergenic
1165330067 19:35136528-35136550 GTGGTCGGCAAGCTTGGGGGTGG + Intronic
1165596165 19:37012494-37012516 GCGGATGCCAAGAGTGGTGGAGG + Intronic
1166307236 19:41941585-41941607 ATACATGCCTAGTTTGGGGGGGG - Intergenic
1166820489 19:45576399-45576421 GTGGGTGCCAGGTGTGGTGGTGG + Intronic
1167295075 19:48645171-48645193 GTGGAAGGAAAGTGTGGGGGTGG - Intronic
1167812376 19:51845634-51845656 GTGGTTACCAAGGCTGGGGGAGG - Intergenic
924963033 2:51183-51205 GTGCTTGCCAACTTTGGAGGTGG + Intergenic
925907445 2:8547806-8547828 GGGGAGGGCAAGTGTGGGGGCGG - Intergenic
926292418 2:11541430-11541452 GTGGATGGCAAGTGAGAGGGGGG + Intronic
926819586 2:16838144-16838166 GTGGTGGCCAAGTGTGGGGAGGG - Intergenic
928272268 2:29867037-29867059 CTGGATGCCAACTTCTGGGGTGG + Intronic
932632194 2:73354647-73354669 GTTGATCCCAAGTTTGGGGCAGG - Intergenic
932667397 2:73708363-73708385 GTGGAGGCCCAGTTGGGGGAGGG - Intergenic
934655123 2:96113314-96113336 CTGGGTGCCAGGTTTTGGGGTGG + Exonic
937954542 2:127414627-127414649 GTGGTTGCCAAGAGTTGGGGTGG + Intergenic
938368087 2:130751221-130751243 GTGGATGCCAAGTGTGGGTGGGG + Intergenic
938402016 2:131001517-131001539 GTGAATGCCAAGTATTGGTGAGG + Intronic
938753031 2:134353029-134353051 GTGGTTACCAAGTTGGGAGGAGG + Intronic
940595477 2:155786754-155786776 GTAGTTTCCAAATTTGGGGGAGG - Intergenic
941173803 2:162172200-162172222 GTGAAAGCCAAAGTTGGGGGCGG - Intronic
944185276 2:196941096-196941118 GTGGTTGCCAAGGGTAGGGGTGG + Intergenic
945372398 2:209035390-209035412 GGGGATGGCAAGTTGGGGGAGGG + Intergenic
946066849 2:216995263-216995285 TTGGATGCCAAGAGTGGAGGTGG + Intergenic
946249423 2:218403497-218403519 TTGGATCCCCAGTTGGGGGGTGG + Intronic
946427772 2:219608505-219608527 GTGGAGGGCCAGTTCGGGGGAGG + Intronic
947575464 2:231270161-231270183 CTGGGAGCCAAGTTTTGGGGTGG + Intronic
947695991 2:232189561-232189583 GTAGTTGCCAAGATTGAGGGAGG + Intronic
947752200 2:232538950-232538972 GGGGATGCCGAGTGAGGGGGAGG + Intergenic
1168801745 20:647795-647817 CTAGCTGCCAAGTTTGGGGATGG + Exonic
1168884805 20:1241599-1241621 GTAGTTCCAAAGTTTGGGGGAGG + Intronic
1168963403 20:1884011-1884033 GTGGCTGCCAGGCTTGGAGGAGG - Intergenic
1169351166 20:4869079-4869101 GTGGCAGCCAAGATTGGGTGGGG + Intronic
1169630397 20:7624638-7624660 GGAGATGCCATGTTTGTGGGTGG - Intergenic
1169952287 20:11058620-11058642 TGAGATGCCAAGTTTGGGGCTGG - Intergenic
1170527119 20:17249822-17249844 GTGGATTCCAGGGCTGGGGGGGG + Intronic
1170578068 20:17679903-17679925 GAGGAGGCTAAGGTTGGGGGAGG - Intronic
1173404018 20:42749274-42749296 GTGGGTGACATGTTTGGGGCTGG - Intronic
1173490363 20:43474727-43474749 GTGGAGGCCAAGTTTGGACAAGG + Intergenic
1174345137 20:49923476-49923498 GTGGAGGCAGGGTTTGGGGGAGG + Intergenic
1174860464 20:54086473-54086495 GTGCATGCCAAGAGTGGGGCAGG - Intergenic
1175790792 20:61738702-61738724 GAGGATGCCAAGCCTGGTGGAGG - Intronic
1178823695 21:35997916-35997938 GTGGATGCCATGCATGTGGGTGG - Intronic
1179122165 21:38558044-38558066 CAGGATGCTAAGTTTTGGGGGGG + Intronic
1179602587 21:42490094-42490116 GTGGGTGCCAGATGTGGGGGAGG - Intronic
1180019707 21:45114463-45114485 GTGGATGCCAGGGTCAGGGGAGG + Intronic
1181173542 22:21023417-21023439 GTGGGTCCCAAGTTGGGGGCAGG + Intronic
1181512218 22:23394123-23394145 GTGGGTGCCAGGCTGGGGGGTGG + Intergenic
1181812962 22:25415447-25415469 GTGGGTGCCAAGCCTGGAGGTGG - Intergenic
1182021461 22:27085212-27085234 GTAGATGCCAAGGTTAGGGTGGG + Intergenic
1182075603 22:27493352-27493374 GTGGATGCCAAGCTGCCGGGTGG + Intergenic
1182108798 22:27708156-27708178 GTAGATTCCATGTTTGGTGGGGG + Intergenic
1182767117 22:32765509-32765531 GTGGAGGACAACTTTGGGGCTGG + Intronic
1183655065 22:39179807-39179829 GGGGATGGCAGGTTTGGGGTGGG + Intergenic
1185066094 22:48632421-48632443 TTTGGTGCCAAGTTTTGGGGTGG + Intronic
1185078400 22:48695682-48695704 GTGGTTCTCAGGTTTGGGGGTGG + Intronic
1185252394 22:49811224-49811246 GTGGCTGCCAGGGCTGGGGGAGG + Intronic
949481117 3:4494290-4494312 CTGCCTACCAAGTTTGGGGGCGG + Intronic
950052731 3:10004583-10004605 GTGGGTGCCAAGTCTGGGCAGGG + Intronic
950414377 3:12860312-12860334 GTGGATGCCAGGTCTGAGGAAGG - Intronic
950414655 3:12862010-12862032 GTGGATGCCAGCTCTGAGGGAGG - Intronic
951344923 3:21536463-21536485 GAGGAAGCCCAGTTTGGGGAGGG + Intronic
951651419 3:24955440-24955462 GTGGTTTCCAGGTTTGAGGGTGG + Intergenic
951679240 3:25277225-25277247 GTGGAGGCCAATATAGGGGGAGG + Intronic
952628566 3:35437905-35437927 GTGGTGGCAAGGTTTGGGGGAGG + Intergenic
953121792 3:40051257-40051279 GTGGATGCTGAGGTTTGGGGTGG - Intronic
953661190 3:44893120-44893142 GTGGATGCTAAATCTAGGGGTGG - Intronic
955236947 3:57148074-57148096 TGGGAGGCCAAGGTTGGGGGGGG + Intronic
955620403 3:60857160-60857182 GTGGATGCCATCTTGGGAGGGGG + Intronic
958771628 3:98433051-98433073 GTGAATGCCCATTATGGGGGAGG + Intergenic
959782545 3:110253607-110253629 GTGGTTGCCAGGGTTGGAGGTGG + Intergenic
959933534 3:112007408-112007430 GTGGTTGCCAGGGTTGAGGGTGG - Intronic
960943253 3:122948198-122948220 GTGGATGCCCTGGCTGGGGGTGG - Intronic
962481280 3:135800685-135800707 GTGGCTGCCAATGCTGGGGGAGG - Intergenic
965806811 3:172550619-172550641 GTGGGTGGCAAGGTTGGGGGTGG + Intergenic
966319385 3:178684323-178684345 GTGGTTGCCAGGGTGGGGGGTGG + Intronic
966892680 3:184418509-184418531 GGGGAGGCCACGTCTGGGGGCGG - Intronic
967929784 3:194682638-194682660 CTGGATGTCAAGTTTAGGGCTGG + Intergenic
968275828 3:197439644-197439666 TTGGATTTCAAGCTTGGGGGTGG - Intergenic
968693479 4:2008640-2008662 GGGGATGGGAAGGTTGGGGGAGG + Intronic
969010146 4:4055252-4055274 GTGGATGCCAAGCAGGGGTGGGG + Intergenic
969196740 4:5569220-5569242 GTGGATGCCAGGTGTGGGGCAGG + Intronic
969580563 4:8062190-8062212 GTGAATGCCCAGATTGGGGAAGG - Intronic
969744080 4:9055991-9056013 GTGGATGCCAAGCAGGGGTGGGG - Intergenic
969803486 4:9588113-9588135 GTGGATGCCAAGCAGGGGTGGGG - Intergenic
970084666 4:12333247-12333269 GTGCCTGCCAAGATTGAGGGTGG + Intergenic
970899971 4:21147248-21147270 TTGGAACCCAGGTTTGGGGGTGG - Intronic
971456076 4:26845539-26845561 GTGGTTGCCAAGGTCAGGGGAGG - Intergenic
973790843 4:54376623-54376645 CTGGATGGAAAGTTTGGGGAAGG - Intergenic
982170405 4:152656074-152656096 GTGGATGCCAACTATGATGGTGG - Intronic
982597650 4:157406142-157406164 GTGGTGGCCCAGTTTGGTGGTGG + Intergenic
983539222 4:168890662-168890684 GTAGATGCCAAGGATGGGGAAGG - Intronic
984114141 4:175658400-175658422 GTGGTTGCCAAGTGTAGGGGGGG + Intronic
988972546 5:36484226-36484248 GTGGAAGCCAAGGTTGCAGGTGG + Intergenic
989068765 5:37489475-37489497 CTGGGTGCCAGGTTTGGTGGTGG + Intronic
990078159 5:51877052-51877074 GTGGATTCAAATATTGGGGGTGG - Intergenic
991322660 5:65392328-65392350 ATGGATGCTAAATTTGGGGGAGG - Intronic
991550220 5:67827301-67827323 GTGGATGGCTAGTTTAGTGGTGG - Intergenic
995383527 5:111563460-111563482 GTGCATGCCAAGTTTGCCTGTGG + Intergenic
996486584 5:124042196-124042218 GATGAGGCCAAGTTTGGTGGGGG + Intergenic
996752007 5:126898021-126898043 GTGGCTGCCTAGGCTGGGGGTGG + Intronic
998164792 5:139836848-139836870 GTGGATGACAAGTTCGGGACAGG + Exonic
998951332 5:147395638-147395660 GGGGGTGCCACCTTTGGGGGTGG + Exonic
999429694 5:151515531-151515553 GTGGATACAAGGTTTGGGGAGGG - Intronic
999651095 5:153768207-153768229 GAGGATTCCAAGGTTAGGGGAGG - Intronic
1001215257 5:169850076-169850098 GTGGAAGACAAGACTGGGGGTGG + Intronic
1001778936 5:174350957-174350979 GCGGATGACAAGTCTGGGGCTGG - Intergenic
1002101126 5:176858151-176858173 GAGGATGCACAGTCTGGGGGTGG + Intronic
1002458641 5:179361270-179361292 GAGGTTGCCAAGTTTTAGGGTGG - Intergenic
1003403899 6:5812320-5812342 GTGGTTGCCAAAGGTGGGGGTGG + Intergenic
1004223602 6:13767563-13767585 GTGGATGCCAACGTTTGCGGGGG + Intergenic
1007761212 6:44134758-44134780 ATGGATGCCAAGGTAAGGGGTGG - Intronic
1007768386 6:44174970-44174992 GTGGTTGCCAAGGTTTAGGGAGG + Intronic
1007956750 6:45924946-45924968 GCGGATGTGATGTTTGGGGGTGG + Intronic
1011706379 6:90005191-90005213 GTGGATGGGGAGTTGGGGGGAGG + Intronic
1013439908 6:110153511-110153533 GACAATGCCAAGTTTGGGTGAGG - Intronic
1015681275 6:135811483-135811505 GGAGATCCCAAGTTTGGGAGGGG - Intergenic
1015889711 6:137957978-137958000 CTGGATGGAAAGTTTGGGAGTGG - Intergenic
1016900025 6:149092119-149092141 TTGGATTCAAGGTTTGGGGGAGG + Intergenic
1017193387 6:151676649-151676671 GAGGGTGCCAAGTCTGGGGAAGG - Intronic
1020271501 7:6599322-6599344 GAGGGTTCCAAGTTTGGGGTTGG + Intronic
1021621237 7:22552794-22552816 GTGGAAGCAAAATTTAGGGGTGG - Intronic
1023656343 7:42425253-42425275 CTGGATGCCCAGGTTGGGGTTGG + Intergenic
1024321865 7:48078962-48078984 GTGGATGCCAGGCTTAGGGTTGG + Intergenic
1025861836 7:65337713-65337735 GTGGAAGGGAAGTTTGGGGTTGG + Intergenic
1026566369 7:71492842-71492864 CTGGATGGAGAGTTTGGGGGTGG + Intronic
1026890439 7:73978730-73978752 GTTGAAGCCAGGTTGGGGGGCGG - Intergenic
1027958888 7:84918771-84918793 GTGGATGTTAATTTTGGGGGAGG - Intergenic
1028909943 7:96196480-96196502 ATGGATGCCAAGGTGGGGGCTGG + Intronic
1029504447 7:100954051-100954073 GTGGTTACCAAGTTTGTGGTAGG - Exonic
1029504759 7:100956310-100956332 GTGGTTACCAAGTTTGTGGTAGG - Exonic
1031719577 7:125155074-125155096 GTAGTTGCCAAGGCTGGGGGAGG - Intergenic
1031916724 7:127570135-127570157 GTAGATGCTAAATTTGGCGGGGG + Intergenic
1033025351 7:137766830-137766852 GTGGGAGCCAAGTTTGGAGTGGG - Intronic
1033680384 7:143588224-143588246 GTGTATGTCAAGCTTAGGGGTGG - Intergenic
1033704510 7:143873588-143873610 GTGTATGTCAAGCTTAGGGGTGG + Intronic
1034519096 7:151604932-151604954 CTGGGTTCCAGGTTTGGGGGAGG + Intronic
1035736518 8:1891392-1891414 TTGCATGCCTAATTTGGGGGTGG + Intronic
1035741976 8:1935458-1935480 GTGGTTGCCGAGACTGGGGGAGG - Intronic
1036561465 8:9903387-9903409 GTGAATGCCAAGAATGGGGCTGG - Intergenic
1037096594 8:14993697-14993719 GTGGATGGCAAGTTTGAGAAGGG + Intronic
1037647170 8:20802902-20802924 ATGGATTCCATGGTTGGGGGAGG - Intergenic
1037940618 8:22948213-22948235 GTGGATGCAAAGTGTGGGGAAGG + Intronic
1038354829 8:26818150-26818172 GTGGTTGCCAAGGATGGGGGTGG + Intronic
1039354018 8:36795361-36795383 GTGGATGCCAGATGTGAGGGGGG - Intronic
1039925970 8:41932764-41932786 GTGGATGCCAAGTTTGGGGGTGG + Exonic
1041461585 8:58117421-58117443 GGGGATGGCAAATTTGGGGGAGG + Intronic
1043152174 8:76731363-76731385 GTGGATGTCAAGTTTGGAGATGG + Intronic
1045044126 8:98258213-98258235 GTGGTTGCCAGAGTTGGGGGAGG + Intronic
1045432978 8:102131106-102131128 GTGGTTATCAAGGTTGGGGGTGG - Intergenic
1046043016 8:108930464-108930486 TAAGATGCTAAGTTTGGGGGAGG + Intergenic
1047724097 8:127669486-127669508 GTGGAGGCTAAGGTTGGGTGGGG - Intergenic
1047787614 8:128168928-128168950 GTGCATGCCCAGTCTGGGGCAGG - Intergenic
1047858615 8:128939614-128939636 CAGAATGCCAAGTTTGGGCGGGG - Intergenic
1048325922 8:133438847-133438869 GTGGCTGACAGGGTTGGGGGAGG - Intergenic
1048606077 8:135970421-135970443 TTGGATACCAAGGGTGGGGGAGG + Intergenic
1049578087 8:143398709-143398731 CTGGGTGCCAGGTGTGGGGGAGG + Intergenic
1050189756 9:3012446-3012468 GTGGCTGCCAGGGTTGAGGGAGG - Intergenic
1055283336 9:74699910-74699932 GTGGATGACCAGTTTGGTGAGGG - Intergenic
1057152838 9:92809513-92809535 GTGGATCGCGGGTTTGGGGGTGG + Intergenic
1059549856 9:115217972-115217994 TTGGATGGCAAGTTTTGGGAGGG - Intronic
1060759641 9:126236416-126236438 GTGGTTGCCCAGTATGGGGTGGG - Intergenic
1060936290 9:127518025-127518047 GTGCATGCCATGTGTGTGGGGGG - Intronic
1061912276 9:133731542-133731564 GTGGATGCCCAGTTGGGGAGGGG - Intronic
1186474022 X:9843167-9843189 GGGGAAGCCCAGTGTGGGGGAGG - Intronic
1187294526 X:17986015-17986037 GTGGAAGCAAAGTCTGGGGCAGG - Intergenic
1190745021 X:53317392-53317414 GTGGATGACATGGATGGGGGTGG + Intronic
1192423090 X:71051362-71051384 GTGGTTGCTAGGGTTGGGGGTGG + Intergenic
1193308479 X:79976950-79976972 GTGGACTCCTAGTTTGGGGGAGG + Intergenic
1193900237 X:87167622-87167644 GTGGAGGCAAAATTTGGGGTTGG - Intergenic
1194647170 X:96471977-96471999 GTGGATATGAATTTTGGGGGAGG - Intergenic
1197965902 X:132061536-132061558 GTGGATGTCAAGATTAGTGGAGG + Intergenic
1198152856 X:133928115-133928137 GTGGCTACCAAGATTGGGGCAGG - Intronic
1200061610 X:153486282-153486304 GTGGATGGCTGGATTGGGGGAGG - Intronic
1200396620 X:155993575-155993597 GTGGTTGTCAAGTTGAGGGGAGG + Intergenic