ID: 1039926385

View in Genome Browser
Species Human (GRCh38)
Location 8:41936451-41936473
Sequence ATGAGCATTTTTACTTTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 425}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039926385_1039926389 15 Left 1039926385 8:41936451-41936473 CCCAACAAAGTAAAAATGCTCAT 0: 1
1: 0
2: 1
3: 37
4: 425
Right 1039926389 8:41936489-41936511 GATAAACACACTGCAGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039926385 Original CRISPR ATGAGCATTTTTACTTTGTT GGG (reversed) Intronic
901478728 1:9509163-9509185 ATTAGCATTGTTATGTTGTTTGG + Intergenic
904744986 1:32704900-32704922 ATGGGCTTTTTTGTTTTGTTGGG + Intergenic
906814361 1:48862809-48862831 TTAAGGATTTTTTCTTTGTTTGG - Intronic
908780957 1:67689266-67689288 ATAAGCATTTTTGCTTTCTTTGG - Intergenic
908781084 1:67690775-67690797 ATGACCCTTTTTTCTTTATTTGG - Intergenic
908901975 1:68966052-68966074 CTGAGCATTTTTATTTTATCTGG + Intergenic
909504024 1:76367572-76367594 CTGAGAACTTTTACTTTGGTGGG - Intronic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
909967925 1:81941267-81941289 ATTAGTATATTTACTTAGTTAGG - Intronic
911167111 1:94734165-94734187 ATGAGAATTTATAATTTGTAGGG - Intergenic
911283102 1:95955875-95955897 ATGACCATGTCTCCTTTGTTCGG + Intergenic
911695563 1:100887337-100887359 GTGAGCTTTCTTACTTTATTAGG + Intronic
912075344 1:105867710-105867732 ACGAGCATTTTTACGTTTGTTGG + Intergenic
912215379 1:107605087-107605109 ATGAGCAATTTTATTTTGGAGGG - Intronic
912280142 1:108304441-108304463 ATGAGCAGTTGTACTGTGATGGG + Intergenic
912288084 1:108389916-108389938 ATGAGCAGTTGTACTGTGATGGG - Intronic
913189802 1:116403982-116404004 ATGGGCATTCTGACTTTGGTTGG + Intronic
913627915 1:120678799-120678821 AGGAACACTTTTACATTGTTGGG + Intergenic
914562190 1:148831036-148831058 AGGAACACTTTTACATTGTTGGG - Intronic
914610639 1:149299186-149299208 AGGAACACTTTTACATTGTTGGG + Intergenic
915672500 1:157502186-157502208 ATGAGAATTTATAGTTTGTAGGG + Intergenic
916293283 1:163189356-163189378 TTGAACATTTTTACCTTGTTGGG - Intronic
917110785 1:171545416-171545438 AAGAGCATTTTTCTTTTGTTTGG + Intronic
917141950 1:171843206-171843228 GTCAGCAATTTTACTTTGTTAGG - Intronic
917763745 1:178194771-178194793 AGGAGCATCTTTTCTTTGCTTGG - Intronic
918429751 1:184447298-184447320 ATGTGCATTTTTTAGTTGTTAGG + Intronic
918525404 1:185458977-185458999 ATGATGAGTTTTACCTTGTTGGG + Intergenic
918807535 1:189068788-189068810 GGGAGTTTTTTTACTTTGTTGGG - Intergenic
919324168 1:196084884-196084906 AAAACCATTTTTACTATGTTGGG - Intergenic
920934819 1:210421974-210421996 TTTATCATTTTTACTTTTTTGGG + Intronic
921201839 1:212814263-212814285 ATGCCCATTTTTAATTTTTTTGG + Intronic
921267389 1:213433732-213433754 TTGAGCATTTTTTATGTGTTTGG + Intergenic
921422338 1:214963102-214963124 ATGAGCACTTGTCATTTGTTTGG + Intergenic
921441418 1:215190923-215190945 ATGAGCATATTAACTGGGTTAGG + Intronic
923496164 1:234526738-234526760 ATGTGAAGATTTACTTTGTTGGG - Intergenic
924524901 1:244837241-244837263 ATGAGCAATTTTTGTTTTTTTGG - Intronic
1063308363 10:4928754-4928776 AGGAAAATTTTTACTTTCTTTGG + Intronic
1063577596 10:7275652-7275674 ATGATGATTTTTACAGTGTTTGG - Intronic
1064044952 10:12005102-12005124 ATGAGTATTTTTTTTTTTTTTGG + Intronic
1064219335 10:13427040-13427062 TTGAGCATTTTTTCGTTGTTGGG - Intergenic
1064727397 10:18294690-18294712 CTGAGCATTTTTCCTTTGCAGGG - Intronic
1064804114 10:19111298-19111320 ATGAGCATTTTCAATTTTTAAGG + Intronic
1065403874 10:25340336-25340358 ATGAGCCTTTTTACATATTTTGG - Intronic
1067197659 10:44136298-44136320 ATAAGAATATTTATTTTGTTAGG + Intergenic
1067894714 10:50166331-50166353 ATGAGCATTTTCAGTGGGTTTGG + Intergenic
1067954126 10:50773931-50773953 ATGAGCATTTTCAGTGGGTTTGG - Intronic
1068755818 10:60651718-60651740 ATGAGAGTATCTACTTTGTTGGG + Intronic
1069068539 10:63971767-63971789 ATTACCAGTTTTATTTTGTTTGG - Intergenic
1069179619 10:65341879-65341901 AATAGCAAATTTACTTTGTTAGG + Intergenic
1069461615 10:68600155-68600177 TTGTGCATTTTTACTTTATAAGG - Intronic
1070419106 10:76218723-76218745 ATCACCATTTTTACTTTCCTTGG + Intronic
1070484605 10:76917827-76917849 ATTAGCATTGTTTCTTTCTTAGG + Intronic
1070997550 10:80799277-80799299 ATGCACATTTTTATTTTCTTGGG - Intergenic
1071281441 10:84107806-84107828 ATGAGGGTCTTTACTTTCTTAGG - Intergenic
1071474205 10:86011368-86011390 ATGAGCATTTATTATTTGCTAGG - Intronic
1071718394 10:88119636-88119658 TTGAGCATTTTTTATGTGTTAGG + Intergenic
1071775192 10:88778707-88778729 ATAGACATTTTTACTTTTTTAGG + Intergenic
1071873222 10:89817345-89817367 AGGAGCAGTTTTTCTTTGTCCGG - Intergenic
1072375285 10:94809451-94809473 TTGTCCATTTTTACTTTGGTTGG + Intronic
1072447257 10:95510145-95510167 ATGACTATTTTTTCTTTTTTTGG - Intronic
1072586406 10:96786771-96786793 ATGAGGTTTTTTTGTTTGTTTGG + Intergenic
1073168459 10:101479453-101479475 ATGAGCAATATTACTTACTTTGG - Exonic
1073975599 10:109097302-109097324 ATGAACACTTTTACACTGTTGGG + Intergenic
1074800015 10:116990556-116990578 ATGAGGGTCTTTACTTTCTTAGG + Intronic
1076018331 10:127047557-127047579 ATGCTCATTTTAATTTTGTTTGG + Intronic
1077839170 11:5955348-5955370 ATAAGAAATTTTACATTGTTGGG - Intergenic
1078585154 11:12579043-12579065 TTGATAATTTTTATTTTGTTAGG - Intergenic
1078705866 11:13743500-13743522 ATCAGCTTTTTTTCTTTATTTGG + Intergenic
1079530644 11:21447914-21447936 ATGAGCATTTCTTCTTTGGCTGG + Intronic
1079699412 11:23524844-23524866 TGGTGCATTCTTACTTTGTTGGG + Intergenic
1079704972 11:23604071-23604093 ATGAGCATTTTTTTTTAGATTGG + Intergenic
1079714352 11:23726064-23726086 CAGAGCATTTGTACTTTTTTAGG + Intergenic
1080063505 11:27982490-27982512 ATGAGTATTTTTTCTCTGTGAGG - Intergenic
1080245389 11:30174280-30174302 ATGAGCATGTCTGTTTTGTTTGG - Intergenic
1081828884 11:46088534-46088556 ATTAGCATTTTTTGTTTTTTGGG - Intronic
1086061774 11:82707433-82707455 ATAAGCATTTGTCATTTGTTGGG - Intergenic
1086429606 11:86723332-86723354 ATGTTCATTCTTACTTTTTTTGG - Intergenic
1087368999 11:97257334-97257356 ATCAGCATTTATACATTTTTTGG - Intergenic
1088057463 11:105602730-105602752 ATGGAAATATTTACTTTGTTGGG - Intergenic
1090702145 11:129306130-129306152 ATGAACATTTTTATTATTTTTGG + Intergenic
1093143686 12:15539055-15539077 CTTAGCATTTTTATTTTGTTAGG - Intronic
1093779401 12:23117500-23117522 ATTACCATATTTACTTTGTAGGG + Intergenic
1094048038 12:26188589-26188611 CTGTCCATTTTTATTTTGTTTGG - Intronic
1094601964 12:31916843-31916865 ATGAGGGTCTTTACTTTCTTAGG + Intergenic
1094618331 12:32056465-32056487 ATGAGAATTTATAGTTTGTAGGG - Intergenic
1097675583 12:62599309-62599331 ATGAGCATTTTTTTTTAATTTGG + Exonic
1097958985 12:65514167-65514189 ATGAGCAGTTTTAACTTGTAGGG + Intergenic
1098766604 12:74498146-74498168 ATGAACAATTTTTCTTGGTTAGG + Intergenic
1098820961 12:75228357-75228379 TTTAGCAGTTTTACCTTGTTGGG + Intergenic
1098948517 12:76614976-76614998 TTGAGAATTTTTACTTGGTTTGG - Intergenic
1099055259 12:77832455-77832477 TTGTGCATTTTTACTTTTATTGG + Intronic
1099263415 12:80413266-80413288 ATCAGCACTTTTAATTTTTTGGG + Intronic
1099917876 12:88918157-88918179 TTGAGCATTTTTATTATGATTGG - Intergenic
1100730881 12:97467060-97467082 ATGAGTGATTTTACTTTGCTTGG + Intergenic
1103657031 12:122479484-122479506 ATGAGAAATTTTACTTTGAGGGG + Intronic
1107087398 13:36440546-36440568 ATGAGCATTATTTGGTTGTTTGG + Intronic
1107286632 13:38801305-38801327 ATTAGCATTTTTAATTCTTTGGG + Intronic
1107584858 13:41834612-41834634 AGGAACATTTTTACACTGTTGGG + Intronic
1107598234 13:41986220-41986242 ATAAGCATCTTTACTGAGTTTGG + Intergenic
1107601052 13:42012786-42012808 ATGCACATTGTTGCTTTGTTTGG - Intergenic
1108141881 13:47432132-47432154 ATTAGCATTTTTGTTTTGTGTGG - Intergenic
1109361142 13:61296460-61296482 ATGAGTCTGTTTACCTTGTTAGG + Intergenic
1109721304 13:66279681-66279703 TTGAGCAATTTTACTTTCTTTGG - Intergenic
1109908835 13:68884134-68884156 ATTAGCATTTTTAATTTGACAGG + Intergenic
1110074531 13:71222816-71222838 TTTAGCATTTTTATTTTGCTTGG + Intergenic
1110781918 13:79476276-79476298 ATTTTCATTTTTCCTTTGTTTGG - Intergenic
1110831674 13:80038805-80038827 ATGAGCATTTGGATTTTGTCTGG - Intergenic
1111015104 13:82370353-82370375 ATGAGATTTTTTTGTTTGTTTGG - Intergenic
1111287850 13:86119058-86119080 ATGAGCCCTTTTAATTTGTTGGG + Intergenic
1112638743 13:101247432-101247454 ATGATCACTTCTACTTTCTTAGG - Intronic
1112655590 13:101449450-101449472 CTGAGCATTTTTGCTTTTTCTGG - Intergenic
1114006499 14:18319437-18319459 ATGATCATTTCTATTTTGTAGGG + Intergenic
1114961059 14:27890243-27890265 ATGAGCTTTTGTAATTTGTATGG - Intergenic
1115367309 14:32572598-32572620 ATGAGTATTCTTAACTTGTTGGG + Intronic
1115871794 14:37812598-37812620 ATGTATATTTTTGCTTTGTTTGG + Intronic
1116581515 14:46648226-46648248 CTCAGCCTTTTTACTTTCTTGGG - Intergenic
1116701248 14:48245686-48245708 ATGGGGATTTTTACTTGCTTTGG + Intergenic
1118019222 14:61694498-61694520 ATGTGCAATGCTACTTTGTTGGG + Intergenic
1118456660 14:65951044-65951066 ATGAACTTTTTTCTTTTGTTTGG - Intergenic
1118509927 14:66460774-66460796 ATGAGCAATTTTATATGGTTTGG - Intergenic
1119944753 14:78681560-78681582 ATAAGTATTTTTCGTTTGTTAGG + Intronic
1121992187 14:98569059-98569081 ATTCTCATTTTTTCTTTGTTGGG + Intergenic
1123872138 15:24587159-24587181 ATGAGTATTTTTACTGTGAGTGG + Intergenic
1124424307 15:29550518-29550540 ATGAGGATTTTTACTCGCTTTGG - Intronic
1124858725 15:33416460-33416482 ATGAGCATTTTTCATATATTTGG + Intronic
1125063238 15:35450068-35450090 ATGAGCACATTTAATTTATTTGG - Intronic
1126496975 15:49302228-49302250 ATCAGTATTTTGACTTTGCTTGG + Intronic
1127505456 15:59593616-59593638 TTGAGCATTTTTTCATAGTTTGG - Intergenic
1127729966 15:61790775-61790797 AAGAGCATTTTTGCTTTCTTTGG + Intergenic
1129032030 15:72626128-72626150 ATGTTCTTTTTTTCTTTGTTTGG - Intergenic
1129406800 15:75324867-75324889 ATGTTCTTTTTTTCTTTGTTTGG - Intergenic
1130441723 15:83961542-83961564 ATGAGAATTTTTAGTTTATTTGG - Intronic
1130576622 15:85098652-85098674 ATCATCATTTCTACTTTTTTTGG - Intronic
1130653609 15:85776587-85776609 ATGTGCATATTTATTTAGTTTGG + Intronic
1131760230 15:95614759-95614781 ATGAAGATTTTTACTTTGTTTGG - Intergenic
1131893611 15:97001783-97001805 ATGGGCATTTTATCTTTCTTTGG + Intergenic
1133167169 16:3956483-3956505 ATGAGCTTTTTTTTTTTTTTTGG + Intronic
1133504935 16:6402384-6402406 TTGTTCATTTTTATTTTGTTTGG - Intronic
1133848480 16:9479439-9479461 ATGAGCATTTTTAATGTCATAGG - Intergenic
1134239993 16:12498820-12498842 CTGAGCAATTTTACTTTTGTTGG - Intronic
1134361537 16:13535322-13535344 ATGAGCATCTTAAATTTCTTAGG + Intergenic
1134375843 16:13672526-13672548 TTGGGCATTTTTCCTCTGTTTGG + Intergenic
1134505062 16:14798486-14798508 ATGTGCATTTTTAATCCGTTAGG + Intronic
1134575513 16:15330423-15330445 ATGTGCATTTTTAATCCGTTAGG - Intergenic
1134726932 16:16426077-16426099 ATGTGCATTTTTAATCCGTTAGG + Intergenic
1134940505 16:18285786-18285808 ATGTGCATTTTTAATCCGTTAGG - Intergenic
1136721599 16:32323181-32323203 AAGAACATTTTTAATTTGTAAGG - Intergenic
1136839979 16:33529469-33529491 AAGAACATTTTTAATTTGTAAGG - Intergenic
1137366942 16:47868411-47868433 TTTAGCCTTTTTACTTTCTTTGG - Intergenic
1138926871 16:61603177-61603199 ATTATTATTTTTATTTTGTTTGG + Intergenic
1139385086 16:66562425-66562447 ATGAGCATTTTTACTTCCCATGG + Intronic
1141238806 16:82245398-82245420 ATGACCATTTATACTGAGTTGGG + Intergenic
1203004833 16_KI270728v1_random:194589-194611 AAGAACATTTTTAATTTGTAAGG + Intergenic
1203136383 16_KI270728v1_random:1730708-1730730 AAGAACATTTTTAATTTGTAAGG + Intergenic
1203145974 16_KI270728v1_random:1799811-1799833 ATGATCTTTTTTTCTTTATTAGG + Intergenic
1203150146 16_KI270728v1_random:1829754-1829776 AAGAACATTTTTAATTTGTAAGG - Intergenic
1143214834 17:5217013-5217035 ATAAACATTTTTAGGTTGTTAGG + Intronic
1144333673 17:14249204-14249226 AGAAGCATTTTTTCTTTTTTTGG + Intergenic
1144487012 17:15674961-15674983 ATGAGCTTCTTTATTTTGTTTGG + Intronic
1144809030 17:17986814-17986836 ATGAGCATTTTTCCTGGGCTTGG - Intronic
1144914016 17:18707339-18707361 ATGAGCTTCTTTATTTTGTTTGG - Intronic
1148365222 17:47050468-47050490 ATGAGCCTTCTCACATTGTTGGG - Intergenic
1148429739 17:47632799-47632821 CTGAATATTTTTACTTTTTTTGG - Intergenic
1149759125 17:59213627-59213649 ATCAGCATTTTTTACTTGTTTGG - Intronic
1150519247 17:65849056-65849078 ATAAGCATTTTTGCTTCATTGGG - Intronic
1150729907 17:67683421-67683443 AGGAGCATTTTCACTTGATTAGG + Intronic
1151093835 17:71473325-71473347 ATGAGCATTATTTTTTTGTTTGG + Intergenic
1153450440 18:5221424-5221446 ATAAGCATTTTTTTTTTGCTGGG - Intergenic
1154124926 18:11683387-11683409 AAGAGCATTTTGTCCTTGTTAGG + Intergenic
1155527023 18:26727538-26727560 ATTTGCTTTTATACTTTGTTAGG + Intergenic
1155823416 18:30407853-30407875 ATTAGCAATTTCAATTTGTTTGG - Intergenic
1156238477 18:35228017-35228039 ATGATCATGTTTACTTTTTGTGG - Intergenic
1156240915 18:35253042-35253064 AAGAGCATTTGTATTTTGTCAGG - Exonic
1156494938 18:37519491-37519513 ATCAGCATTTTGCCGTTGTTTGG + Intronic
1156581917 18:38387231-38387253 ATGATCATTTGTATTTAGTTTGG - Intergenic
1157072741 18:44428388-44428410 ATGAGGTTTTTTAAATTGTTTGG + Intergenic
1157428791 18:47606269-47606291 ATGAGAATTTGTAGTTTGTAGGG + Intergenic
1157875406 18:51268735-51268757 ATGAGCATTTTAACGTATTTTGG - Intergenic
1158252026 18:55499722-55499744 AAGAGCATTTTTACTGTGAGGGG + Intronic
1162952971 19:14082768-14082790 ATGAGAACTTTTATTTTGGTGGG + Intronic
1163574840 19:18104606-18104628 ACGACTATTTTTACTTTGGTGGG - Intronic
1164195581 19:22955042-22955064 AGGAACACTTTTACATTGTTGGG + Intergenic
1164859785 19:31553931-31553953 ATGAACATTTTTGTCTTGTTTGG - Intergenic
1168454936 19:56499423-56499445 ATGAGAATTTATAGTTTGTAGGG - Intergenic
925225962 2:2184610-2184632 ATGAGTGTTATTCCTTTGTTTGG - Intronic
925619235 2:5774660-5774682 AAGAGCAGTTTCACTTTCTTTGG - Intergenic
925822087 2:7809350-7809372 ATGATCATTTTTATTTTTTGTGG + Intergenic
926843771 2:17110809-17110831 ATGTGCATATTTCCTTAGTTTGG + Intergenic
928847161 2:35690206-35690228 ATGAGCTTTTTAATTTTTTTTGG + Intergenic
928970932 2:37028483-37028505 ATGAGCTTTTTTATATTGTTGGG - Intronic
930314647 2:49782883-49782905 AGAAGCATAGTTACTTTGTTAGG + Intergenic
930760249 2:55026648-55026670 ACAAACATTTTTCCTTTGTTAGG - Exonic
931238859 2:60434874-60434896 GGGAGCATTTTACCTTTGTTGGG + Intergenic
931317104 2:61143301-61143323 ATGAGAATTTATGGTTTGTTGGG + Intergenic
931541365 2:63333190-63333212 ATGAGAATTTTTGGTTTGTAGGG - Intronic
931689342 2:64822087-64822109 ATAAGCATCTGTACCTTGTTGGG + Intergenic
932782097 2:74565890-74565912 CTGAGCATTTTTATTATGTAAGG - Intronic
934155667 2:89197752-89197774 ATGAGAATTTATAGTTTGTAGGG - Intergenic
934211657 2:89985007-89985029 ATGAGAATTTATAGTTTGTAGGG + Intergenic
936923492 2:117712991-117713013 AGAAGCTTTTTTAGTTTGTTTGG + Intergenic
937731131 2:125231076-125231098 ATAAGCCTTTTTACCTAGTTTGG + Intergenic
937790967 2:125961183-125961205 ATGTGCATTTTTATTTTAATAGG - Intergenic
938908377 2:135861155-135861177 TTGAACATTTTTAGTTGGTTTGG - Intronic
939039250 2:137168152-137168174 ATGTGCCTTTTTCCCTTGTTAGG + Intronic
939422156 2:141985497-141985519 ACGAGAATTTTTATTTTTTTGGG + Intronic
939731577 2:145791094-145791116 ATGACCATTTTTCTCTTGTTTGG - Intergenic
939977283 2:148732751-148732773 AATAGCATTTATAGTTTGTTTGG + Intronic
940250599 2:151671562-151671584 ATGATCATTTCTATTTTATTAGG - Intronic
942721564 2:178958873-178958895 ATGAGCTTTTTTTTTTTTTTTGG + Intronic
942929666 2:181474269-181474291 ATGAGCATTTTATTTATGTTTGG + Intronic
943186789 2:184617824-184617846 TTGAGCACTTATTCTTTGTTAGG + Intronic
944250423 2:197575445-197575467 TTGAGCATTTATACTGTGTAAGG - Intronic
945007348 2:205422916-205422938 ATGAGGATGTTTCATTTGTTAGG - Intronic
945529237 2:210929923-210929945 ACGAGCATTTTTTATTTCTTTGG + Intergenic
945596270 2:211798495-211798517 ATAATAATCTTTACTTTGTTGGG + Intronic
945689703 2:213018267-213018289 ATGAGCTTATTTATTTTATTGGG - Intronic
945831927 2:214797924-214797946 ATTAGTATCATTACTTTGTTAGG - Intronic
945959324 2:216115627-216115649 ATAAGCCTTTTTACATTGATGGG - Intronic
946686074 2:222271427-222271449 ATCACCATTATTACTATGTTTGG - Intronic
946790323 2:223294245-223294267 ATCAGAATTTTTAATATGTTTGG - Intergenic
947292680 2:228594769-228594791 TTGAGCATTTATACTCTGTGAGG - Intergenic
1169778732 20:9285373-9285395 ATTATCATTTTTACTTTCTGTGG + Intronic
1170026724 20:11896866-11896888 ATGAGCATATTGTCTTGGTTGGG + Intronic
1170646409 20:18199760-18199782 ATAAACATTTTAAATTTGTTTGG - Intergenic
1173165025 20:40682150-40682172 TTGAGGACTTTTATTTTGTTGGG + Intergenic
1173362281 20:42355416-42355438 ACGAGCATTTTTCCTTAGTTTGG - Intronic
1173775243 20:45700470-45700492 ATTATCATTTTTATATTGTTTGG - Intronic
1174722101 20:52823822-52823844 ATGCTCATGTTTGCTTTGTTGGG - Intergenic
1174801415 20:53566044-53566066 ACGAGCATTTCTCCTTTTTTTGG + Intergenic
1175476481 20:59278561-59278583 TTGAGGATTTTGACTTTGTCAGG + Intergenic
1175584380 20:60126389-60126411 GTGAGCATTTCTTCTTTGTGAGG - Intergenic
1175643021 20:60647420-60647442 ATGATCATTTTTCCTTTTTCAGG - Intergenic
1175778561 20:61668065-61668087 GTGAGCATTCCTAATTTGTTAGG + Intronic
1177706962 21:24718915-24718937 ATGAACATTTTAACATTTTTAGG + Intergenic
1177777037 21:25579705-25579727 TTCAGCATTTTTATGTTGTTAGG - Intergenic
1178248865 21:30982369-30982391 ATGAGCATTTTTCATTCATTGGG - Intergenic
1178666204 21:34549168-34549190 ATGAGCATGTGTGCTTTGTTTGG + Intronic
1178747595 21:35267949-35267971 TTGAGCATGTTTTCATTGTTGGG - Intronic
1179200994 21:39220539-39220561 TTGTGAATTTTTACCTTGTTGGG - Intronic
1179915218 21:44473055-44473077 AGGAGTATTTTTAATTTATTTGG + Intergenic
1180431008 22:15250248-15250270 ATGATCATTTCTATTTTGTAGGG + Intergenic
1180761767 22:18215834-18215856 CTGAGCTTTTTTCCTTTTTTGGG + Intergenic
1180773900 22:18408776-18408798 CTGAGCTTTTTTCCTTTTTTGGG - Intergenic
1180805250 22:18658320-18658342 CTGAGCTTTTTTCCTTTTTTGGG - Intergenic
1180805494 22:18711088-18711110 CTGAGCTTTTTTCCTTTTTTGGG + Intergenic
1181069959 22:20327490-20327512 CTGAGCTTTTTTCCTTTTTTGGG - Intergenic
1181193002 22:21155701-21155723 CTGAGCTTTTTTCCTTTTTTGGG - Intergenic
1181216440 22:21336873-21336895 CTGAGCTTTTTTCCTTTTTTGGG + Intergenic
1181852343 22:25758754-25758776 ATGAGAATTTTTTTTTTTTTTGG + Intronic
1183267907 22:36840965-36840987 ATGTGCATTTTTAATTTGGATGG - Intergenic
1183787179 22:40036505-40036527 ATAAACAATTTTAGTTTGTTTGG + Exonic
1203235732 22_KI270731v1_random:149750-149772 CTGAGCTTTTTTCCTTTTTTGGG - Intergenic
949612820 3:5720334-5720356 CTTGGCAGTTTTACTTTGTTAGG + Intergenic
949854038 3:8443696-8443718 ATTAATATTTTTACATTGTTTGG + Intergenic
950588653 3:13917970-13917992 ATGAGCATTTTTCATATGTTTGG + Intergenic
952441122 3:33330281-33330303 ATCAGCATTTTTTTTTTTTTTGG - Intronic
955702359 3:61694505-61694527 ATGCGTATTTTTACTTTCTGTGG - Intronic
956986338 3:74705461-74705483 ATGAGCCTTGTTACATTTTTTGG - Intergenic
958673180 3:97231300-97231322 AAGAGCTTACTTACTTTGTTTGG + Intronic
959420534 3:106122708-106122730 ATGAGTATTTACATTTTGTTTGG - Intergenic
959550819 3:107655053-107655075 CTGTACATTTTTACTATGTTGGG + Intronic
959794833 3:110413520-110413542 ATGAGGATTTTTACTTCCTGAGG + Intergenic
960288005 3:115851420-115851442 ATGAGCAGTTTTACCTCCTTGGG + Intronic
961936725 3:130592437-130592459 ATGAGCATTCACACTTTTTTTGG + Intronic
963030484 3:140968829-140968851 ATGAGAATTTTTACCTAGATTGG + Intronic
963170292 3:142243391-142243413 ATGAGGATCTTTGCTTTGTTAGG + Intergenic
963287066 3:143443560-143443582 ATGAGCATTTTTAATTTGCCTGG + Intronic
963571297 3:147000097-147000119 ATGTGCATTTTCACTTTTCTTGG - Intergenic
964387388 3:156162847-156162869 ATGAGGATTTTTGCTTCCTTTGG - Intronic
965487601 3:169297157-169297179 TTTAGCATTTTTGGTTTGTTTGG - Intronic
966167823 3:177041040-177041062 TTGACTATGTTTACTTTGTTGGG - Intronic
966575131 3:181492533-181492555 TTGAGCAATTTTTCTCTGTTGGG - Intergenic
967416891 3:189229166-189229188 ATGGACATCTTTACTATGTTGGG - Intronic
967694188 3:192512755-192512777 ATATGCATTTTTACTTAGTGGGG - Intronic
967755368 3:193162553-193162575 ATGAGAATTTTTGGTTTGTAGGG - Intergenic
970486905 4:16533864-16533886 ATGAAGATTTTTACTTCGGTAGG - Intronic
971074794 4:23134988-23135010 ATGAGCTTTTTTTCTCTGTTTGG - Intergenic
971600529 4:28585896-28585918 ATGAGCCTGTCTCCTTTGTTTGG + Intergenic
971713537 4:30147832-30147854 ATGAGAATTTATAGTTTGTAGGG - Intergenic
971732152 4:30398407-30398429 AAGAGCATTTATACTATATTTGG + Intergenic
973048221 4:45563211-45563233 ATGTGCATTTATCCTTAGTTAGG - Intergenic
974050088 4:56932883-56932905 ATATGCATGTTTATTTTGTTTGG + Exonic
975280140 4:72552633-72552655 ATGAGCCATTTTACTTTGAGTGG - Intronic
975331712 4:73123297-73123319 ATGGGGATTTTTACTTTTTCTGG + Intronic
976004222 4:80409128-80409150 CTGAGAATTTGTACATTGTTAGG + Intronic
976136357 4:81941023-81941045 ATGAGCATTTTTACTATAAAGGG - Intronic
976365345 4:84227486-84227508 ATGGGCATTTATACTCTGTGAGG - Intergenic
976374456 4:84328291-84328313 ATAAGCATTTTTACCCTGCTAGG + Intergenic
977486343 4:97650947-97650969 ATGAGAATTTATGCTTTGTAGGG + Intronic
977723954 4:100272230-100272252 TTGAGCACTTTTTCTGTGTTAGG + Intergenic
979254325 4:118595890-118595912 ATGACCATTTTTTCTTTTTCAGG + Intergenic
979653820 4:123167865-123167887 TTGAGCATTTTAATTTTGTTAGG + Intronic
979982973 4:127279183-127279205 ATGAGCTCTTTTACTTTTTTTGG - Intergenic
980871643 4:138617795-138617817 ATGAGCTGTTGTATTTTGTTGGG + Intergenic
981458160 4:144980224-144980246 AGGAACATTTTTACACTGTTGGG - Intronic
982147635 4:152414542-152414564 CTGATCATTTATCCTTTGTTAGG - Intronic
982604196 4:157493090-157493112 ATGTGCATATTTATTTTGTCAGG - Intergenic
982680988 4:158430040-158430062 ATGTGTATTTTAATTTTGTTGGG - Intronic
983033435 4:162832820-162832842 ATAAGCATATTAAATTTGTTAGG + Intergenic
983273839 4:165593677-165593699 ATGAGAATTTATGCTTTGTAGGG + Intergenic
983383741 4:167030575-167030597 ATTAGCCTGTTTACATTGTTTGG + Intronic
983500800 4:168497121-168497143 ATGAGCATTTCTTCTTTTCTGGG - Exonic
984079914 4:175235052-175235074 GTGACCACTTTTCCTTTGTTTGG - Intergenic
984170836 4:176357609-176357631 ATTGGCATTTTGATTTTGTTGGG + Intergenic
985200463 4:187479462-187479484 GAGAGTATTTTTATTTTGTTAGG + Intergenic
985327793 4:188792106-188792128 AAGACCATTTATAGTTTGTTTGG - Intergenic
986727361 5:10609122-10609144 ATGAGCTATTTTACCTTTTTTGG - Intronic
986868408 5:12016971-12016993 ATGAACATTTTTATTTTCATTGG + Intergenic
986888767 5:12274287-12274309 ATGAGTATTTTTCCTTGTTTGGG + Intergenic
988318490 5:29661951-29661973 ATGAGCATTTTTATGTTTGTTGG - Intergenic
988863767 5:35312389-35312411 ATCAGCATTTTTTCTTTCTTTGG + Intergenic
989043805 5:37254762-37254784 AGAAGCTTTTTTACTTTATTTGG + Intergenic
990079680 5:51898154-51898176 ATGAGTATTATTACATTGTATGG - Intergenic
990630862 5:57667538-57667560 TTGTGCATTTTTCCTTTTTTTGG + Intergenic
990819218 5:59818302-59818324 ATAATCATCTTTACCTTGTTAGG + Intronic
992923740 5:81557900-81557922 ATTATGAATTTTACTTTGTTGGG + Intronic
993830733 5:92754503-92754525 ATGAACATCTTTTCTTTCTTGGG - Intergenic
993993461 5:94688860-94688882 ATGAGCAGTTTTATTTCTTTTGG - Intronic
994230736 5:97308481-97308503 ATGAGCATCTTTTCTTTTATTGG + Intergenic
994964917 5:106656991-106657013 ATGAGCAATTGTACTATGATTGG - Intergenic
995056665 5:107766813-107766835 ATCTGCATTTCTACTTTCTTTGG + Intergenic
996247223 5:121279925-121279947 ATGAGAAAGCTTACTTTGTTTGG - Intergenic
996977739 5:129455530-129455552 TTGATCAATTTTAATTTGTTTGG - Intergenic
997594723 5:135099290-135099312 ATCAGCAGTTTTACTTTCTGCGG - Intronic
997636459 5:135410276-135410298 ATGGACATCTTTACTATGTTGGG + Intergenic
998201307 5:140125131-140125153 ATGGGCATTTTTTTTTTCTTGGG - Exonic
998337438 5:141385216-141385238 ATGAGCATGTCTACATAGTTGGG - Exonic
999512047 5:152262567-152262589 AAAAGCAGTTTTACTTTGTCAGG - Intergenic
1000643260 5:163730755-163730777 ATTAGTATTTTTAATTTATTTGG + Intergenic
1000715995 5:164644997-164645019 GTCAGAATTTTTACTTAGTTTGG + Intergenic
1000998840 5:167986040-167986062 ATGAGGTTTTTTTGTTTGTTAGG + Intronic
1002403345 5:179007243-179007265 TTGAGTATTTTTTCCTTGTTTGG - Intergenic
1003759788 6:9164918-9164940 ATGAGCATTCTGCCATTGTTAGG - Intergenic
1004136946 6:12976546-12976568 ATCAGCAATTTTACTTTCTGTGG + Intronic
1005600183 6:27418884-27418906 ATGAGTATTTTTATTTTTTTTGG + Intergenic
1006125711 6:31836584-31836606 GTGACTATTTTTACTTTTTTGGG + Intronic
1008029987 6:46684804-46684826 ATGAGCATGTTTCCTTTCTTTGG + Intergenic
1008085216 6:47237285-47237307 ATGAGCATTTTTTTTTCTTTTGG - Intronic
1008100945 6:47391033-47391055 ACTGCCATTTTTACTTTGTTTGG + Intergenic
1008114890 6:47537790-47537812 ATGAGAATTTTTTTTTTTTTTGG + Intronic
1009190590 6:60624718-60624740 AAGAGCATTTTTTTTTTTTTTGG + Intergenic
1009476918 6:64104056-64104078 ATGTACATTTTGATTTTGTTGGG + Intronic
1009891424 6:69688233-69688255 ATGAACATTTTAACTTTAATTGG + Intronic
1010883312 6:81206761-81206783 TTGAGCATTTTCATTTTCTTTGG - Intergenic
1011952702 6:92986697-92986719 ATGAGCATTTTTAATTTCTGTGG - Intergenic
1012002202 6:93666959-93666981 ATGAGCATTTTTTCCTTATTTGG + Intergenic
1012061224 6:94484799-94484821 ATTAGTAATTTTACTATGTTGGG + Intergenic
1012116005 6:95299485-95299507 ATGAGCATTTTTTCATTGTCTGG + Intergenic
1012226434 6:96708888-96708910 ATAAGTATTTATACTTTGTAAGG - Intergenic
1013392479 6:109700548-109700570 ATGGGCATTCTTATTTTGGTTGG + Intronic
1013587684 6:111594131-111594153 GTGAGCATTTTTTTTTTTTTTGG - Intronic
1014174344 6:118315279-118315301 ATCAGCACCTTGACTTTGTTAGG - Exonic
1014323305 6:119959305-119959327 ATGAACTTTTATACTTTCTTTGG + Intergenic
1014503020 6:122216205-122216227 ATGAGAATTTTTACTCTGGTTGG - Intergenic
1015214024 6:130729432-130729454 ATGAGCTTTTTTCATATGTTTGG - Intergenic
1016209228 6:141507753-141507775 ATGTGAATTTGGACTTTGTTAGG + Intergenic
1016547183 6:145237623-145237645 ATGAGAATTTATAGTTTGTAGGG - Intergenic
1016687359 6:146896572-146896594 ATGAGCTTTTTTTTTTTTTTTGG - Intergenic
1017117866 6:150996016-150996038 ATGAGCATTTTTTGTTGTTTTGG - Intronic
1018876958 6:167829464-167829486 ATGATTATTTTTACTCTATTTGG + Intronic
1020774284 7:12433425-12433447 ATAAATATTATTACTTTGTTTGG - Intergenic
1021000982 7:15329846-15329868 ACGAGCATCCTTACTTTGTTGGG + Intronic
1021826964 7:24563377-24563399 ATAAGTAATTTTAGTTTGTTGGG + Intergenic
1022567870 7:31421643-31421665 GTGATCATTTATACTTTGATAGG - Intergenic
1022619601 7:31969520-31969542 AGGAACATTTTTACACTGTTGGG + Intronic
1022673238 7:32475598-32475620 ATAAGCATTTTTTCTTGCTTGGG - Intergenic
1022951051 7:35338315-35338337 ATGAACATTTTAATTATGTTCGG + Intergenic
1023162912 7:37314775-37314797 ATGATGATGTTTTCTTTGTTCGG - Intronic
1023230635 7:38024354-38024376 ATGAACATATTAACTTTATTAGG - Intronic
1023580252 7:41674380-41674402 ATGGCCATTTTTTTTTTGTTTGG + Intergenic
1023708691 7:42968972-42968994 ATAAAAATTTATACTTTGTTTGG + Intergenic
1024664379 7:51531318-51531340 ATGAGCTTTTTAAAATTGTTTGG + Intergenic
1025767645 7:64471180-64471202 ATCAGAATTTTTACTTAATTAGG + Intergenic
1026208074 7:68276594-68276616 ATAAGCATTTTTATTTTATAAGG + Intergenic
1026391725 7:69909700-69909722 ATGAGAATTTTTATTCTGTTTGG - Intronic
1027738207 7:81962876-81962898 AACAGCATTGTTTCTTTGTTGGG - Intronic
1028229057 7:88284294-88284316 CAGAGCATTTATATTTTGTTGGG - Intronic
1028823180 7:95236605-95236627 TTGAATATTTTTACTTTTTTAGG + Intronic
1029931292 7:104374041-104374063 ATGAGGATTTATAGTTTGTAGGG + Intronic
1030003455 7:105091430-105091452 TTGAGCATTTTTATTTGGTTTGG + Intronic
1030832254 7:114239433-114239455 ATGGGTATTTTTATTTTGGTAGG + Intronic
1030872192 7:114770062-114770084 ATGAGCATTTTCAGTTTCATTGG - Intergenic
1031354463 7:120774344-120774366 ACGTGAATTTTTTCTTTGTTGGG + Intergenic
1032510228 7:132466445-132466467 ATAAGCATATCTACTTTGTAGGG + Intronic
1032902739 7:136328995-136329017 GTCAGCATTTTCAATTTGTTGGG - Intergenic
1033380042 7:140807183-140807205 ATGAGGCTTTTTTCTTTGTCTGG - Intronic
1034522880 7:151633785-151633807 ATTGTCATTTTTACTATGTTGGG - Intronic
1034824038 7:154244457-154244479 ATTAGCATATTTACTATTTTTGG - Intronic
1035509973 8:171771-171793 AGGAGCAATTTTTTTTTGTTGGG - Intergenic
1036721676 8:11181306-11181328 ATAAGCATTTTTAGATTCTTTGG + Intronic
1038760540 8:30381638-30381660 ATGAGCATTTTAAGTCTGATGGG - Intergenic
1038833167 8:31085915-31085937 ATAATCATCTTTACTTTCTTTGG + Intronic
1038956266 8:32471782-32471804 ATCAGCTTGTTTACCTTGTTTGG - Intronic
1039926385 8:41936451-41936473 ATGAGCATTTTTACTTTGTTGGG - Intronic
1040778648 8:51078972-51078994 ATGATCATTTTTACCTTTTCTGG - Intergenic
1041073166 8:54144839-54144861 ATGAGCATCTTTTCTTATTTTGG + Intronic
1041398163 8:57413244-57413266 ATAAGCACTTTTATTCTGTTTGG - Intergenic
1041551689 8:59109924-59109946 ATGAACACTTTTACTTAATTAGG - Intronic
1041852900 8:62413028-62413050 ATGAGCATCTTTCATATGTTTGG - Intronic
1041987635 8:63944730-63944752 ATTATGAATTTTACTTTGTTGGG + Intergenic
1042319248 8:67457693-67457715 ATGAGCATTTTTTTTTTCTGGGG - Intronic
1042431226 8:68708972-68708994 ATGATCATTTTTAATTATTTAGG + Exonic
1043466794 8:80516740-80516762 AGAGACATTTTTACTTTGTTGGG + Intronic
1044482438 8:92707610-92707632 AGGTGCATTTTTATTTGGTTTGG + Intergenic
1044971029 8:97619958-97619980 ATGAGCAGATTTACTGTCTTAGG - Intergenic
1045686542 8:104718682-104718704 ATGAGCAATTTTCCTTTTCTTGG + Intronic
1045780684 8:105859601-105859623 ATGAGAAATTTGACTGTGTTTGG + Intergenic
1046142478 8:110112653-110112675 ATGACCATATTTACTTGATTTGG + Intergenic
1046205532 8:110990679-110990701 ATATGCATTTGTACTATGTTAGG + Intergenic
1046585398 8:116144569-116144591 CTGAGTCTTTTTATTTTGTTAGG - Intergenic
1046754382 8:117957810-117957832 ATTAGCATTTTTATCTTCTTTGG - Intronic
1047546308 8:125820852-125820874 ATGAGCATTTTTTTTTTTTTTGG + Intergenic
1048017508 8:130510739-130510761 AGGAACATTTTTACACTGTTGGG - Intergenic
1049461289 8:142729365-142729387 ATGAGCCTGTCTCCTTTGTTCGG - Intronic
1049461765 8:142733019-142733041 ATGACCCTGTTTCCTTTGTTGGG - Intronic
1049933185 9:475578-475600 ATGAGAATTTTTGGTTTGTAGGG - Intronic
1050471567 9:5996778-5996800 ATAAGCATTTTTAGTAAGTTAGG + Intronic
1050798866 9:9583527-9583549 ATGAGCATTATTATTTCTTTAGG - Intronic
1050969963 9:11857710-11857732 ATTAGCATTTTAATTGTGTTTGG - Intergenic
1051366266 9:16323552-16323574 TAGAGCATTTTGACTTTCTTTGG + Intergenic
1051773520 9:20607108-20607130 ATGAGTATTTTTATTTAATTTGG + Intronic
1052017459 9:23485773-23485795 ATGTTCATTTTTACTTCATTTGG + Intergenic
1052748980 9:32469346-32469368 ATAAGCATTTGAACTATGTTGGG + Intronic
1055027972 9:71742616-71742638 GTGACCATTTTGACTTTCTTAGG - Intronic
1056124845 9:83525809-83525831 TTGATCGTTTTTCCTTTGTTAGG - Intronic
1056604461 9:88075243-88075265 ATAAGCATTTTTAGATTTTTGGG + Intergenic
1056875981 9:90331198-90331220 ATGAGAATTTTTGGTTTGTAAGG - Intergenic
1058055587 9:100445444-100445466 ATGAGTTTTTTTACATTTTTAGG - Intronic
1058154444 9:101499199-101499221 AGGGGCTTTTTTACTTTATTTGG - Intronic
1058573130 9:106370076-106370098 ATGATTATTTTTAATTTGTCAGG + Intergenic
1058956683 9:109955226-109955248 ATGAGGCTTTGTACTGTGTTGGG + Intronic
1059714318 9:116899458-116899480 ATGATCATTATTATTTTGTGGGG - Intronic
1060706324 9:125805005-125805027 TTGAGCTTTTATATTTTGTTGGG + Intronic
1060780119 9:126405560-126405582 ACGCCCATTTTTACTTTATTTGG - Intronic
1203366230 Un_KI270442v1:259544-259566 AGGAACATTTTTACACTGTTGGG + Intergenic
1203653375 Un_KI270752v1:102-124 ATGAGGTTTTTTGTTTTGTTTGG + Intergenic
1185795563 X:2961443-2961465 ATGAGAATTTTTGGTTTGTAGGG - Intronic
1186118054 X:6325969-6325991 TTGGGCATTTTTACATGGTTTGG - Intergenic
1186548186 X:10473474-10473496 ATGAGCATTTTTTCTTTGCGAGG - Intronic
1187568037 X:20472293-20472315 ATGAGCATTGTTACTTTAAATGG + Intergenic
1187955154 X:24510408-24510430 ATGAGCACTTTTATTATTTTGGG - Intronic
1188550563 X:31360051-31360073 ATGAGCAATTTTTTTTTTTTTGG + Intronic
1189642083 X:43084202-43084224 ATTAATATTTTTACTTTTTTTGG + Intergenic
1190176340 X:48153623-48153645 ATGTGCATTTGTACTTTCTAAGG - Intergenic
1190448100 X:50551097-50551119 ATGAGCTTTTCTTCTTTCTTAGG - Intergenic
1190497870 X:51044080-51044102 ATGGCCATTTTCACTTTGATGGG + Intergenic
1190810703 X:53880732-53880754 ATGAGAATTTATAGTTTGTAGGG - Intergenic
1192423618 X:71055981-71056003 ATGTACATTTTAATTTTGTTAGG - Intergenic
1192913167 X:75626824-75626846 TTGAGCATTTTTTATATGTTTGG + Intergenic
1193511996 X:82413748-82413770 ATAATCTTTTTTACTTTATTTGG + Intergenic
1194359510 X:92932132-92932154 AAGAGTATGTTTACTTTGGTAGG - Intergenic
1196301851 X:114057206-114057228 ATGAGAATTTATAGTTTGTACGG - Intergenic
1196375703 X:115030426-115030448 ATGACTATTTTTAATTTTTTTGG - Intergenic
1196502854 X:116405672-116405694 ATAAGGAGTTTTAGTTTGTTTGG - Intergenic
1196634050 X:117979286-117979308 ATTACCATTTTTAAATTGTTTGG + Intronic
1197464982 X:126792671-126792693 ATTAGGATTTTTACTTTCTTAGG + Intergenic
1198581128 X:138065830-138065852 ATGAGCATATTTATAGTGTTCGG + Intergenic
1199365414 X:146974970-146974992 ATTAGCATTGTTAATTTGTTTGG + Intergenic
1199491950 X:148410065-148410087 AAGAGCATTTTTTCTTGATTGGG - Intergenic
1199852222 X:151733303-151733325 ATTGTGATTTTTACTTTGTTGGG + Intergenic
1200016392 X:153167016-153167038 AGAAGCATTTTTACATTGATAGG - Intergenic
1201610772 Y:15840523-15840545 ATGAGAATTTGTATTGTGTTTGG - Intergenic
1201902361 Y:19056749-19056771 ATTAGGAATTTTACTTTGTAGGG - Intergenic
1202027489 Y:20540094-20540116 ATGGGTATTTTTTCTTTGATGGG - Intergenic