ID: 1039927312

View in Genome Browser
Species Human (GRCh38)
Location 8:41947024-41947046
Sequence GAGTCTTCTCACTTCTAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039927312_1039927313 15 Left 1039927312 8:41947024-41947046 CCACTCTAGAAGTGAGAAGACTC 0: 1
1: 0
2: 0
3: 13
4: 154
Right 1039927313 8:41947062-41947084 GTTTTCTTTCTCTCCTGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039927312 Original CRISPR GAGTCTTCTCACTTCTAGAG TGG (reversed) Intronic
903564246 1:24252879-24252901 CAGTCCTCTCATTTATAGAGGGG - Intergenic
905687407 1:39918461-39918483 TAGTTTTCTCATCTCTAGAGAGG + Intergenic
906281544 1:44557859-44557881 CAGCCTTCTCACTTCCAGACTGG + Intronic
906653087 1:47527235-47527257 GAGTGTTCTCACTTATAAATGGG - Intergenic
907588534 1:55643525-55643547 CAGGCTTCTCCCTTCTCGAGAGG + Intergenic
910102857 1:83597217-83597239 GAGACTTCTCAGACCTAGAGAGG + Intergenic
916191029 1:162178528-162178550 GAGTCTCCTCACCTATAAAGTGG - Intronic
916281442 1:163055643-163055665 GCGTCTACTCACTTCTGGTGAGG + Intergenic
919310687 1:195903206-195903228 GAGTCTTCTCCCTTTGAGTGGGG - Intergenic
920160666 1:203995630-203995652 GATTCTTCTCAGTTCTAGCTGGG - Intergenic
922010159 1:221575430-221575452 GCTTTTTCTCACTTATAGAGGGG - Intergenic
923179535 1:231502877-231502899 GAGTGTTCTCACTTTTAAATGGG - Intergenic
923499537 1:234553358-234553380 GAAGCTTGTCACTTCCAGAGCGG + Intergenic
924804047 1:247348349-247348371 CAGTCTTCCCATTTCTAGGGAGG + Intergenic
1063760319 10:9067404-9067426 GAGTCTCCTCAATTACAGAGAGG + Intergenic
1064681418 10:17814354-17814376 TAGACTTTTCACTTCAAGAGGGG + Intronic
1066468678 10:35675988-35676010 GAGTCTTCCCACTTCTGGTCTGG - Intergenic
1066588985 10:36971688-36971710 GATGCTTCTCACTTCTCAAGTGG + Intergenic
1066658806 10:37720195-37720217 GGCTCTTCTCACTTCCAAAGAGG + Intergenic
1067043204 10:42969437-42969459 GGCTCTTCTCACTTCCAGAGAGG + Intergenic
1067824730 10:49562464-49562486 GATTCTTCTGACTTCTACACAGG + Intergenic
1068302179 10:55158126-55158148 GAATTTCTTCACTTCTAGAGTGG - Intronic
1069058383 10:63867966-63867988 CAGTTTTCTCACCTCTAGAATGG - Intergenic
1070786024 10:79162684-79162706 TAGTCTCCTCACTGCGAGAGTGG - Intronic
1072474243 10:95744173-95744195 CAGGCTTCTCACTGTTAGAGTGG - Intronic
1074248881 10:111723856-111723878 TAGGCTTCTCACTTCCACAGTGG + Intergenic
1074903973 10:117844391-117844413 CAGTTTTCTCATTTGTAGAGTGG + Intergenic
1076011812 10:126995137-126995159 GACGCTCCTCACTTCTAGACGGG + Intronic
1076340288 10:129740775-129740797 GAGACTTCTCACCTGCAGAGTGG + Intronic
1083139783 11:60712434-60712456 GAGAATTCTCTCTTCTGGAGAGG - Intronic
1084230165 11:67746380-67746402 CATGCTTCTCACCTCTAGAGTGG + Intergenic
1084586149 11:70063932-70063954 AAGTCTTCAGACTTCTGGAGTGG + Intergenic
1085542725 11:77287645-77287667 TAGTTTTCTCACCTCTAAAGTGG + Intronic
1085899090 11:80676247-80676269 GATGCTTCTCACTTCTCAAGTGG - Intergenic
1087358513 11:97125910-97125932 CAGTTTTCTCACTATTAGAGTGG - Intergenic
1088389834 11:109301721-109301743 TAGTGTTCTCATTTCTAAAGTGG + Intergenic
1088822465 11:113468384-113468406 GAGTCTTCTCACTTATTATGAGG + Intronic
1090160076 11:124483321-124483343 GTGTTTTCTCACTTTTAAAGCGG - Intergenic
1091975434 12:4820974-4820996 GAGTCTTCTGAATTTTATAGCGG + Intronic
1092553448 12:9528741-9528763 GAGTCTTCTAACTTCTTTACTGG + Intergenic
1092925908 12:13271984-13272006 TTGTCTGCTCACCTCTAGAGTGG + Intergenic
1094518651 12:31161882-31161904 GAGTCTTCTAACTTCTTTACTGG - Intergenic
1096054437 12:48639671-48639693 GAGTGTTCTCACTCCTGGAGGGG - Intergenic
1097081008 12:56430856-56430878 GAGTATTCTTACATCTGGAGTGG - Intronic
1098652811 12:72994399-72994421 CAGTCTTCTCACTTTCGGAGTGG - Intergenic
1098867716 12:75781762-75781784 GACTTTTCTCAATTCTAGAATGG + Intergenic
1099747893 12:86730953-86730975 CAGTTTTTTCATTTCTAGAGTGG - Intronic
1099780390 12:87187403-87187425 CTGGCTTCTCATTTCTAGAGTGG - Intergenic
1100012205 12:89967181-89967203 TTGTCTTCTCAATTCTAGAAGGG + Intergenic
1101997814 12:109537516-109537538 GAGACATCTGACTTCCAGAGAGG - Intergenic
1102359822 12:112275521-112275543 CAGTTTCCTCATTTCTAGAGTGG + Intronic
1103952703 12:124559622-124559644 GAGTTGTCTCAGTTCTTGAGGGG - Intronic
1104522324 12:129487125-129487147 TAGTCTTCTCACAGCTGGAGTGG - Intronic
1107182293 13:37474930-37474952 GTGTGTTCTCACTTATAGATGGG + Intergenic
1108095708 13:46898323-46898345 CAGTCTTCTCACTTGTAAAATGG + Intergenic
1109678619 13:65716009-65716031 GAGTCTCTTCACTTGTAAAGTGG + Intergenic
1110844761 13:80181623-80181645 GAGGCTGCTCACTGCTAGACTGG + Intergenic
1111095962 13:83516194-83516216 AAGTGTTCACAATTCTAGAGAGG - Intergenic
1112665006 13:101559742-101559764 CAGTCTTTTCACTTGTAGAATGG + Intronic
1119529876 14:75352600-75352622 GAGCCCTCTCACCTCTGGAGGGG + Intergenic
1121661670 14:95639863-95639885 GAGTCTTCTCACTTACAGACTGG + Intergenic
1125184561 15:36915595-36915617 GATTCTCCTTACTTCTGGAGGGG - Intronic
1126188842 15:45857933-45857955 GAGTATTTTCACTTCAATAGAGG - Intergenic
1128703066 15:69818235-69818257 CAGTTTTCTCACCTGTAGAGTGG + Intergenic
1131858756 15:96628584-96628606 GACTGTTATCACTTCTAGACTGG - Intergenic
1140489074 16:75318945-75318967 GTGCCTTCTCATTTCTAGAAAGG - Intronic
1141078307 16:81028992-81029014 GTCTCTTCTCAATTCTGGAGAGG + Intronic
1142396255 16:89833447-89833469 GAGTCTTCTCATTTGTAAAATGG - Intronic
1146456626 17:33014264-33014286 GAGCCTTCTCACTGCCATAGGGG - Intronic
1147628629 17:41915935-41915957 CAGACTTCTTTCTTCTAGAGAGG - Intronic
1150863590 17:68826124-68826146 GAGACTCCTCCCTTCAAGAGAGG - Intergenic
1151006250 17:70439701-70439723 TGGTCTTCTCTCTTCTTGAGGGG - Intergenic
1153088352 18:1315901-1315923 GAGTTTTCTCCCTTGTGGAGAGG - Intergenic
1153116498 18:1663196-1663218 GAGTCTGATGACTTCTTGAGAGG - Intergenic
1159103112 18:63977229-63977251 CAGTCTTCTCATCTCTAAAGTGG + Intronic
1159205561 18:65246508-65246530 GTATCTTCTGACTCCTAGAGTGG - Intergenic
1166520411 19:43476335-43476357 GAGTTTTCTCACGTGTAGAATGG - Intronic
926660109 2:15455696-15455718 CAGTCTTCTCACTTGTAAAGTGG - Intronic
928331349 2:30360255-30360277 CAGTCTTCTCACCTGTAAAGCGG + Intergenic
930869442 2:56155041-56155063 GAGACTGCTGACTTCCAGAGAGG + Intergenic
931216837 2:60253069-60253091 CAGCCTTCTCACTTCAAGAAAGG + Intergenic
931532622 2:63233381-63233403 GAGTCTACACAGTTCAAGAGTGG + Intronic
937289178 2:120771751-120771773 GAGTCTTCTGCCTTCCAGAGGGG + Intronic
938400814 2:130989849-130989871 GAGTTTTCTCACCTCTAAAATGG + Intronic
942304667 2:174594819-174594841 AAGTCTTTTCACTTCTTCAGAGG - Intronic
942842918 2:180385208-180385230 GAGTATTGTCACTTCTGCAGAGG - Intergenic
943121767 2:183744874-183744896 TAGTTTTCTCATTTCTAGAGTGG - Intergenic
943709061 2:191069615-191069637 GAGTTTTCTCACTGACAGAGTGG - Intronic
948584343 2:239009609-239009631 GAGTCTTCTCTGTCCTTGAGGGG - Intergenic
1170576417 20:17665149-17665171 ATGTCATCTCCCTTCTAGAGGGG + Intronic
1171450202 20:25230440-25230462 GGCTCTTCTGACCTCTAGAGAGG - Intergenic
1174845971 20:53943487-53943509 GAGTCATCTCAGATATAGAGTGG + Intronic
1176418289 21:6492847-6492869 GAGGCTTATCCCTTCTAGGGAGG - Intergenic
1178050404 21:28740738-28740760 GAGTCTGCTCAAGTCTAGATAGG + Intergenic
1178052478 21:28763294-28763316 GCATCTTCTCACTTCTGGTGAGG + Intergenic
1179693782 21:43101169-43101191 GAGGCTTATCCCTTCTAGGGAGG - Intronic
1182970516 22:34570404-34570426 CAGGCTTCTCACTGCTGGAGTGG - Intergenic
1183830443 22:40415979-40416001 GAGTGTTGTCACATCTAGATTGG - Intronic
949971111 3:9405573-9405595 GAGTCTTCACATTTCAGGAGTGG - Intronic
952437781 3:33289410-33289432 GACTTTTCTCACTACCAGAGTGG - Intronic
954955306 3:54513483-54513505 CAGTTTTCTCACCTCTAAAGTGG - Intronic
957046732 3:75381408-75381430 CATGCTTCTCACCTCTAGAGTGG + Intergenic
959755851 3:109898172-109898194 GTGGCTTCTCACTTCTAGGAGGG + Intergenic
960005217 3:112774863-112774885 CAGTTTTCTCATTTCTAAAGTGG + Intronic
960751655 3:120961497-120961519 GCGTGTTCTCACTTATAGAGGGG - Intronic
961878797 3:130045476-130045498 CATGCTTCTCACCTCTAGAGTGG + Intergenic
962058245 3:131897302-131897324 CAGTTTTCTCACCTGTAGAGTGG + Intronic
963518942 3:146340658-146340680 TAGTCTTCTCACCTCTACAATGG + Intergenic
963979152 3:151516622-151516644 AAGTCTTCACTCTTCTAGAAGGG + Intergenic
963979181 3:151517005-151517027 AAGTCTTCACTCTTCTAGAAGGG + Intergenic
969824318 4:9745011-9745033 CATGCTTCTCACCTCTAGAGTGG - Intergenic
970850299 4:20594865-20594887 TAGTCTCCTCACCTGTAGAGTGG + Intronic
971854286 4:32024041-32024063 CAGTCTTTTCTCTTCTACAGTGG - Intergenic
973114298 4:46436462-46436484 GCGTGTTCTCACTTATAGGGGGG - Intronic
973191898 4:47394933-47394955 GAGTCTGCTCACTTCCAGGGAGG - Intronic
976121131 4:81783481-81783503 GTGTTTTCTCACATTTAGAGGGG - Intronic
976829289 4:89295709-89295731 CAGCCCTCTCATTTCTAGAGAGG + Intronic
979597404 4:122549334-122549356 CAGTTTTCTCACTTGTAAAGTGG - Intergenic
984129437 4:175855675-175855697 GAGGCTTCTCACTATTGGAGTGG + Intronic
984822430 4:183893535-183893557 GAGTCTTCACCCTTCTAGTCGGG + Intronic
988910722 5:35839311-35839333 GAGTCTTCTCTCTTTTACATGGG - Intergenic
990062546 5:51669890-51669912 GAATCTTCTCACTTATAGGTGGG - Intergenic
993597663 5:89879636-89879658 GAGTCTTCTATCTTCTACAGTGG + Intergenic
993845100 5:92931739-92931761 TGGTCTTCTGACTTCTATAGTGG - Intergenic
994030781 5:95140117-95140139 AAGGCATCTCATTTCTAGAGAGG + Intronic
994790490 5:104220181-104220203 CAGTCTTCTCATTTCTAAAATGG + Intergenic
996896946 5:128495760-128495782 GAGTCTTCTCTTTTTTATAGAGG - Intronic
997526111 5:134554310-134554332 GCATATTCTCACTTCTGGAGAGG - Intronic
1000005714 5:157182468-157182490 AATTCTTTTCACTTCTAAAGAGG - Intronic
1000082788 5:157863439-157863461 GGGTCCTATCACCTCTAGAGAGG + Intergenic
1003745319 6:8994712-8994734 AAGTCTCCACCCTTCTAGAGAGG + Intergenic
1004268857 6:14175928-14175950 GAGACTTCTGACTTCTAGAATGG + Intergenic
1009402900 6:63277373-63277395 CAATATTCCCACTTCTAGAGAGG - Intronic
1011958312 6:93053004-93053026 GAGTGTTCTCACGTATACAGGGG - Intergenic
1013453687 6:110310453-110310475 AAGTCTTCTCATGTCTGGAGTGG - Intronic
1015414721 6:132935301-132935323 GAGTCTTGTTACTTATATAGAGG + Intergenic
1018873406 6:167799989-167800011 GAGTCCTCTCTCTTCTAAGGAGG - Intergenic
1020313857 7:6890404-6890426 CATGCTTCTCACCTCTAGAGTGG + Intergenic
1022519211 7:30995069-30995091 TAGTTTTCTCACTTGTAAAGTGG - Intergenic
1023579688 7:41668489-41668511 TAGCCTTCACATTTCTAGAGAGG - Intergenic
1023771357 7:43559567-43559589 CAGTTTTCTCACTTGTAAAGTGG - Intronic
1028247567 7:88499527-88499549 TAGTTTTCTCATTTGTAGAGTGG + Intergenic
1031308120 7:120159717-120159739 GAGTTTTCTCAATGTTAGAGTGG - Intergenic
1032938968 7:136767014-136767036 TTGTCTTATAACTTCTAGAGGGG + Intergenic
1033494059 7:141876486-141876508 GGATCTTCTCTCTTCTACAGTGG + Intergenic
1034787082 7:153935656-153935678 GAGTCTCCTCATTTGTAGAGGGG - Intronic
1035137291 7:156716787-156716809 GACTCTTCTCACTTTTAAAAAGG + Intronic
1038078152 8:24101407-24101429 TATTTTTCTCACTTGTAGAGTGG + Intergenic
1039796883 8:40923325-40923347 CAGTCCTCACACTTCTGGAGAGG + Intergenic
1039927312 8:41947024-41947046 GAGTCTTCTCACTTCTAGAGTGG - Intronic
1042813948 8:72857415-72857437 GCTTCTTCTCACTCCTAGAAGGG - Intronic
1044069044 8:87733144-87733166 CAGGTTTCTCACTGCTAGAGTGG + Intergenic
1044173898 8:89092570-89092592 GAGGCTTCTCAGTTCTAAAGGGG + Intergenic
1048164580 8:132051133-132051155 CAGTTTTCTCATCTCTAGAGTGG - Intronic
1048443984 8:134479646-134479668 GAGTCTTCAGACTTACAGAGGGG + Intronic
1050036573 9:1442435-1442457 GAGTGTTTTCACTCCTGGAGTGG + Intergenic
1050987279 9:12099314-12099336 AAGTTTTCTCACTTCTTGAATGG - Intergenic
1055607231 9:77983468-77983490 CAGTCCTCTCAGTTCCAGAGGGG - Intronic
1058739974 9:107933279-107933301 GACTCTTCTCACTTCCCGAAAGG + Intergenic
1058810900 9:108638058-108638080 GAATCTCCTCACTACTAGTGAGG + Intergenic
1188421365 X:29993813-29993835 AATTCTACTCACTTCTAGAGCGG - Intergenic
1189067565 X:37826973-37826995 CAGTAATCTCACTTCTAAAGTGG + Intronic
1190848069 X:54212716-54212738 CAGGTTTCTCACTTCTGGAGTGG + Intronic
1192830419 X:74745281-74745303 GAGGCTTAGAACTTCTAGAGTGG - Intronic
1194577528 X:95631316-95631338 GAGTCTCCTCTCTGATAGAGAGG + Intergenic
1195538940 X:106040346-106040368 CAGTTTTCTCACCTCTAAAGTGG + Intergenic
1198215099 X:134548495-134548517 GCGTCTTGTCACTTCAGGAGAGG + Intergenic
1202139283 Y:21704437-21704459 GAGTCTTATTACTGTTAGAGAGG - Intergenic