ID: 1039927626

View in Genome Browser
Species Human (GRCh38)
Location 8:41951496-41951518
Sequence GCCCCCAACAAGATTCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039927626_1039927629 2 Left 1039927626 8:41951496-41951518 CCCTAGAGAATCTTGTTGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1039927629 8:41951521-41951543 CTTTTAGTGATCTTCCTGGCAGG No data
1039927626_1039927633 27 Left 1039927626 8:41951496-41951518 CCCTAGAGAATCTTGTTGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1039927633 8:41951546-41951568 CTAGGTCTCAGCTATCAAACAGG No data
1039927626_1039927630 9 Left 1039927626 8:41951496-41951518 CCCTAGAGAATCTTGTTGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1039927630 8:41951528-41951550 TGATCTTCCTGGCAGGACCTAGG No data
1039927626_1039927628 -2 Left 1039927626 8:41951496-41951518 CCCTAGAGAATCTTGTTGGGGGC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1039927628 8:41951517-41951539 GCTGCTTTTAGTGATCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039927626 Original CRISPR GCCCCCAACAAGATTCTCTA GGG (reversed) Intronic
903040973 1:20530231-20530253 GTCCTCAACAAGTTTCTCGAAGG - Intergenic
907378906 1:54068817-54068839 GGCTTCAACAAGATTCTCTTTGG - Exonic
910576592 1:88772390-88772412 GCACCCAACATGATGCTCAAAGG + Intronic
921559543 1:216640445-216640467 GCCACCAACCAGCTTCCCTAAGG - Intronic
1062989116 10:1799096-1799118 GCCCCCAAATTGATTCTCTCAGG + Intergenic
1065313618 10:24440466-24440488 GCCACAAACAAGATTCTCAGAGG - Intronic
1067347220 10:45445306-45445328 GCCTCCAACCTGCTTCTCTAAGG - Intronic
1070599831 10:77857787-77857809 GACCCCAACAAGGGTCTCTAAGG - Intronic
1071152663 10:82652930-82652952 GCCCCCAAAATGTTTCTCTAGGG + Intronic
1073679794 10:105690451-105690473 GCTCCCAAGAAGATTGTGTAAGG - Intergenic
1079087263 11:17455471-17455493 GCCCCCAACAAAATAACCTAGGG + Intronic
1079800825 11:24866424-24866446 GCCTGCAATAAGATTTTCTAAGG + Intronic
1079940221 11:26671309-26671331 GGCCTAAACAAGATTCTCTCAGG - Intronic
1088977389 11:114827986-114828008 ACCTCCAACCTGATTCTCTAGGG + Intergenic
1090246594 11:125220561-125220583 TCCCCCAACATGCTTCTCTCCGG - Intronic
1092347419 12:7727300-7727322 GCCCCCAATAAGTTTTTCTTTGG - Intergenic
1095579888 12:43785389-43785411 GTACCCAACAAATTTCTCTATGG - Intronic
1097158423 12:57028983-57029005 GCCCCCACCCAGGTTCTCTGGGG - Intronic
1103163002 12:118745854-118745876 TCCACCAACATGATCCTCTAGGG - Intergenic
1110348206 13:74473913-74473935 TCCCTCAACAGGATGCTCTATGG + Intergenic
1110358848 13:74601623-74601645 GCCCCCAACAATATATTGTATGG - Intergenic
1111922469 13:94426878-94426900 GCCCCAAACAAGATTTTTCATGG - Intergenic
1112583422 13:100695938-100695960 GCCACCCCCAGGATTCTCTAGGG - Intergenic
1118910579 14:70058980-70059002 GCCACCAACAATATTCTCAGAGG - Intronic
1119437337 14:74605915-74605937 GTCCCCAAGGAGAGTCTCTAAGG + Intronic
1119464767 14:74847943-74847965 GCCCCAAAAAAGAATTTCTAAGG - Intronic
1121483804 14:94298220-94298242 GCCCCCATAGAGATTCTGTATGG + Intergenic
1121483811 14:94298224-94298246 GCCCCCATACAGAATCTCTATGG - Intergenic
1122976700 14:105173840-105173862 GCCCCCAACCAGATACCCTGAGG + Intronic
1124236656 15:27994779-27994801 GCCCCCAAGGAAATTATCTAGGG + Intronic
1126441607 15:48695657-48695679 TCCCCCAGCAGAATTCTCTAAGG + Intergenic
1128762169 15:70224762-70224784 TTCCTCAACAAGATTCTCTGTGG - Intergenic
1136640669 16:31562657-31562679 ACCTTCAACAACATTCTCTATGG - Intergenic
1141488911 16:84358802-84358824 GCCCCCAATATGATTCGCAAAGG - Intergenic
1141760349 16:86025111-86025133 GAGCCCTACAAGCTTCTCTATGG - Intergenic
1143952078 17:10641100-10641122 TTCCCAAACAGGATTCTCTATGG - Exonic
1146630125 17:34463683-34463705 GCCACCAACAACGTTCCCTATGG - Intergenic
1147591107 17:41683899-41683921 GACCTCAATAAGATTCTCCAAGG - Intergenic
1150032322 17:61752408-61752430 GCCCACTAGAAGATTATCTAGGG + Intronic
1155529128 18:26748015-26748037 CCTCTGAACAAGATTCTCTAGGG + Intergenic
1156495505 18:37523040-37523062 GCCCACAACCAGATTCACAAGGG + Intronic
1157929548 18:51806214-51806236 TCCCCCAACAAAATTCACAAAGG - Intergenic
1161044217 19:2126354-2126376 GCCCACAAAAATATTTTCTAAGG - Intronic
933546561 2:83720606-83720628 GCCACCACCAGGGTTCTCTATGG - Intergenic
942338316 2:174915342-174915364 GCCCCCAGCCAGCTTCTCTGTGG + Intronic
942440624 2:176031707-176031729 GACCCAAACAAGACTCTCTAAGG + Intergenic
946965910 2:225037759-225037781 CTCCACAACCAGATTCTCTAAGG - Intronic
1174812169 20:53655414-53655436 TCCCCCAATAACATTATCTATGG + Intergenic
1181507155 22:23367139-23367161 GCCCTCAATAAGAAACTCTAGGG + Intergenic
1184064237 22:42107279-42107301 TCCCCTTACAAGATGCTCTATGG - Intergenic
952852848 3:37743036-37743058 CCTCCCAACAAGGTCCTCTAAGG - Intronic
953142469 3:40241484-40241506 ACATCCAACAAGATGCTCTAAGG + Intronic
955916005 3:63908955-63908977 ACCACCAACTAGATTGTCTATGG - Intronic
957885959 3:86287716-86287738 GCCACAGACAAGATTTTCTAGGG - Intergenic
966351651 3:179037893-179037915 GCCCTCAAGAAGCTTTTCTAGGG + Intronic
969332234 4:6481678-6481700 GGCCCCAACAGGATTTTCAATGG - Intronic
974268148 4:59612807-59612829 GTCCCTAACAAAATTCTCTGTGG + Intergenic
978666008 4:111182914-111182936 TCCCCCAGCAAGCTTCTCTCTGG + Intergenic
981753330 4:148114768-148114790 GCCCCAACCTAGATTGTCTATGG - Intronic
982923436 4:161304926-161304948 GCCCCCACAAAGAATCTCTATGG + Intergenic
983301282 4:165929186-165929208 GCCACCAACACGATTTTCTTTGG + Intronic
993472703 5:88325324-88325346 GCACCCAACAAGTTTCAGTATGG + Intergenic
996366189 5:122703738-122703760 GCCCCCAACAAAATTTTTTATGG + Intergenic
1001241579 5:170075637-170075659 GCCCCCAAGTAGATTCTTTAAGG + Intronic
1001788385 5:174433469-174433491 GCCACCTCCAAGATTCTCAAAGG - Intergenic
1012969616 6:105714753-105714775 TCTCACAACAAGATTATCTAAGG - Intergenic
1016939488 6:149472676-149472698 GTCCCCAAAGAGATTCTCTTTGG - Intronic
1018354686 6:163000503-163000525 GCTCCCAACATGATGCTATAAGG - Intronic
1019704978 7:2493301-2493323 GTCCCCGACAAGATGCCCTATGG - Intergenic
1022363722 7:29688016-29688038 GCTCTCAACAAGAGTCTCAAGGG - Intergenic
1023153610 7:37225694-37225716 GCTCCAAAATAGATTCTCTAAGG + Intronic
1024237438 7:47408962-47408984 GTCCCCAACGGGATCCTCTAGGG + Intronic
1027949979 7:84803457-84803479 GCCCCCAACATGATTTTATTTGG + Intergenic
1028774554 7:94662665-94662687 TCCCCAAAGAAAATTCTCTATGG - Intronic
1033720580 7:144055138-144055160 GCCTCCTGCAAGATTCTCGATGG - Intergenic
1034311146 7:150089617-150089639 GCACTCAACAACATTCTCAATGG + Intergenic
1034795709 7:154011027-154011049 GCACTCAACAACATTCTCAATGG - Intronic
1035021196 7:155801469-155801491 GCCACCAACAACCTTCTCTTAGG - Exonic
1036214321 8:6866502-6866524 GACCCCAACAAACTTGTCTATGG + Intergenic
1039927626 8:41951496-41951518 GCCCCCAACAAGATTCTCTAGGG - Intronic
1051582287 9:18689965-18689987 GCTCACAACAAGATTATTTATGG - Intronic
1055392063 9:75833616-75833638 GGCCACATCAAGATTTTCTAAGG - Intergenic
1186528996 X:10276533-10276555 GCCTCCAAAAAGTTTCTCTCTGG + Intergenic
1191760486 X:64642880-64642902 GCCCACAACAAGGCTCTCTAAGG + Intergenic
1201867346 Y:18669441-18669463 GACCCCAACAAGATCCACTGGGG - Intergenic