ID: 1039930442

View in Genome Browser
Species Human (GRCh38)
Location 8:41982619-41982641
Sequence ATGGGTAGTGTATGCAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 146}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039930442_1039930445 -5 Left 1039930442 8:41982619-41982641 CCCACACTGCATACACTACCCAT 0: 1
1: 0
2: 2
3: 15
4: 146
Right 1039930445 8:41982637-41982659 CCCATTTGTTAGTCACTTAGTGG No data
1039930442_1039930448 4 Left 1039930442 8:41982619-41982641 CCCACACTGCATACACTACCCAT 0: 1
1: 0
2: 2
3: 15
4: 146
Right 1039930448 8:41982646-41982668 TAGTCACTTAGTGGTTGTCTGGG No data
1039930442_1039930447 3 Left 1039930442 8:41982619-41982641 CCCACACTGCATACACTACCCAT 0: 1
1: 0
2: 2
3: 15
4: 146
Right 1039930447 8:41982645-41982667 TTAGTCACTTAGTGGTTGTCTGG No data
1039930442_1039930449 22 Left 1039930442 8:41982619-41982641 CCCACACTGCATACACTACCCAT 0: 1
1: 0
2: 2
3: 15
4: 146
Right 1039930449 8:41982664-41982686 CTGGGTTATCAGACTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039930442 Original CRISPR ATGGGTAGTGTATGCAGTGT GGG (reversed) Intronic
902155837 1:14485562-14485584 AGGGGCAGTTTATGCAGGGTGGG - Intergenic
902387968 1:16086820-16086842 GCGGTAAGTGTATGCAGTGTGGG - Intergenic
908241356 1:62191765-62191787 AGGGGTAGAGTATGCAGGTTGGG - Intergenic
908505192 1:64790342-64790364 GTGGGTAATGTATACAGAGTAGG - Intronic
913084905 1:115427830-115427852 ATTTGTAGTGTATGCAGTCATGG - Intergenic
915951783 1:160194078-160194100 ATGTGTAGTGTGTGGTGTGTAGG - Intronic
916841941 1:168609833-168609855 ATGGGTGGGGTATGAAGTGTGGG + Intergenic
918932164 1:190868430-190868452 TTGCATTGTGTATGCAGTGTTGG + Intergenic
919026508 1:192178226-192178248 ATGGGAAATGTATGCAGGGAAGG + Intronic
921069480 1:211647165-211647187 ATTGGTAGTGTATGCTGAATGGG - Intergenic
922856837 1:228782785-228782807 GTGTGTAGAGTATGCTGTGTGGG + Intergenic
924012166 1:239677068-239677090 CTGAGTCTTGTATGCAGTGTAGG - Intronic
924223844 1:241904697-241904719 ATGGGGAGTGCATGGAGTTTGGG - Intergenic
1065256966 10:23879882-23879904 AAGGGATGTGTATGCAGTGGAGG + Intronic
1065834871 10:29647585-29647607 ATGGGTAGTAAAAGCAGTGAAGG - Intronic
1066153552 10:32650783-32650805 ATGGGTTCTGGGTGCAGTGTGGG + Intronic
1070095428 10:73333044-73333066 ATGGGTAATGTAAGCAGAGATGG + Intronic
1071279124 10:84083742-84083764 ATGAGTAATATATGCAGAGTTGG - Intergenic
1071885152 10:89941539-89941561 ATGGGTGGTGTCTGAAGTGAGGG + Intergenic
1072949090 10:99836720-99836742 CTGGGTAGTGAAGGCAGTGGAGG + Intronic
1075266540 10:121003746-121003768 GTGTGTAGTGAATGAAGTGTGGG + Intergenic
1077269805 11:1670514-1670536 GTGGGTAGTGTGGGCAGTGTGGG + Intergenic
1077269809 11:1670532-1670554 GTGGGTAGTGTGGGCAGTGTGGG + Intergenic
1077269813 11:1670550-1670572 GTGGGTAGTGTGGGCAGTGTGGG + Intergenic
1077269822 11:1670595-1670617 GTGGGTAGTGTGGGCAGTGTGGG + Intergenic
1077269826 11:1670613-1670635 GTGGGTAGTGTGGGCAGTGTGGG + Intergenic
1077269834 11:1670658-1670680 GTGGGTAGTGTGGGTAGTGTGGG + Intergenic
1077269846 11:1670721-1670743 GTGGGTAGTGTGGGCAGTGTGGG + Intergenic
1077269851 11:1670748-1670770 GTGGATAGTGTGGGCAGTGTGGG + Intergenic
1077269868 11:1670820-1670842 ATGGGCAGTGTGGGTAGTGTGGG + Intergenic
1077269886 11:1670910-1670932 GTGGATAGTGTGGGCAGTGTGGG + Intergenic
1077269900 11:1670982-1671004 GTGGATAGTGTGGGCAGTGTGGG + Intergenic
1077269904 11:1671000-1671022 GTGGGTAATGTGGGCAGTGTGGG + Intergenic
1077269916 11:1671063-1671085 GTGGATAGTGTAGGTAGTGTGGG + Intergenic
1077269920 11:1671081-1671103 GTGGGTAGTGTGGGCAGTGTGGG + Intergenic
1077269923 11:1671099-1671121 GTGGGCAGTGCAGGCAGTGTGGG + Intergenic
1078184575 11:9040659-9040681 ATGGGGAGGGTACACAGTGTGGG + Intronic
1078209832 11:9261869-9261891 TTTGTTAGAGTATGCAGTGTTGG - Intronic
1079011052 11:16828653-16828675 AAGGGCAGTGGATACAGTGTGGG - Intronic
1080839512 11:35971174-35971196 AAGGGTAGTGTAGGCAGGGGTGG - Intronic
1082829095 11:57602184-57602206 ATGGGCAGTGTCTGCAGAGGAGG + Intronic
1087552062 11:99664029-99664051 ATGGCTAGTGTCTACAGTATTGG + Intronic
1089902585 11:122003075-122003097 ATGGGTAATGTAAGCAGAGATGG + Intergenic
1091971716 12:4793049-4793071 CGGTGTAGGGTATGCAGTGTGGG + Intronic
1092569116 12:9702452-9702474 ATGGGTAGAGGATGGGGTGTGGG + Intergenic
1093514583 12:19971460-19971482 AAGGGTAGGGTATGCAGGCTGGG + Intergenic
1096114312 12:49046400-49046422 GTGTGTCCTGTATGCAGTGTGGG - Exonic
1096195063 12:49644418-49644440 ATGGGTGGTATATGCCATGTGGG + Exonic
1096974623 12:55693064-55693086 AAGGGTAGTGAGTGCAGTGATGG - Intronic
1097616941 12:61895382-61895404 AGGGGTAGTGTATGCTTTATGGG - Intronic
1099802150 12:87470915-87470937 ATGAGTAATGTATGAAATGTAGG - Intergenic
1100016139 12:90013127-90013149 ATGGGAAATGTATGCAGCATTGG + Intergenic
1100381923 12:94070526-94070548 ATGGGAAGAGTAGGGAGTGTTGG + Intergenic
1101640535 12:106583310-106583332 ATGGGAAGAGCATGCATTGTGGG + Intronic
1102155641 12:110725493-110725515 ATGTGGAGTCTGTGCAGTGTTGG - Intronic
1106061798 13:26300312-26300334 GTGAGTAGAGTATGCAGCGTGGG + Intronic
1108782767 13:53856920-53856942 ATGGGTATTTTATGCAATGCTGG - Intergenic
1108992496 13:56678893-56678915 AGGGGGAATGTATGGAGTGTGGG - Intergenic
1111008871 13:82286144-82286166 AGGGGTAGGGTATGCAGGCTGGG + Intergenic
1111533924 13:89576895-89576917 ATGAGTAGAGAATACAGTGTTGG + Intergenic
1112400484 13:99073202-99073224 AGGGGTAGGATATGCAGGGTGGG - Intronic
1115015086 14:28601604-28601626 CTGGGTAAAGTATGCACTGTGGG + Intergenic
1119176850 14:72574800-72574822 ATGAGCAGAGTGTGCAGTGTGGG + Intergenic
1129931297 15:79412921-79412943 AGGGTTAGGGTATGCAGTCTAGG + Intronic
1129934451 15:79437775-79437797 GTGGGTAGTGTGTGGGGTGTGGG + Intronic
1129934642 15:79438464-79438486 GTGGGTAGTGTGTGGGGTGTGGG + Intronic
1129934652 15:79438491-79438513 GTGGGTAGTGTGTGGGGTGTGGG + Intronic
1129934662 15:79438518-79438540 GTGGGTAGTGTGTGGGGTGTGGG + Intronic
1129934875 15:79439254-79439276 GTGGGTAGTGTGTGGGGTGTGGG + Intronic
1130272369 15:82458720-82458742 AGGGGTAGTGGAGGAAGTGTGGG + Intergenic
1130464720 15:84186073-84186095 AGGGGTAGTGGAGGAAGTGTGGG + Intergenic
1130487965 15:84408731-84408753 AGGGGTAGTGGAGGAAGTGTGGG - Intergenic
1130499546 15:84487464-84487486 AGGGGTAGTGGAGGAAGTGTGGG - Intergenic
1130587012 15:85190687-85190709 AGGGGTAGTGGAGGAAGTGTGGG + Intergenic
1132332802 15:101024496-101024518 ATGGGTAGGGGATGCCCTGTGGG - Intronic
1136618861 16:31414778-31414800 GTGGGGAGTGGATGCAGTGGAGG + Intronic
1140225948 16:73077315-73077337 ATCTGTAGTGAATGCAGTGTTGG - Intergenic
1140894392 16:79312264-79312286 TTGTGTTGTGTATGCAGTGGAGG - Intergenic
1142363783 16:89639302-89639324 ATGGGTTGTGTGTGCAGGGGTGG - Intergenic
1142894423 17:2964607-2964629 ATGGGTAGTGTTTGGGGTGAAGG + Intronic
1146498923 17:33347781-33347803 ATGGGTAGCGGAGGCAGGGTGGG + Intronic
1149635537 17:58165996-58166018 ATGGGTAGTGAATCAACTGTGGG + Intergenic
1149911826 17:60573847-60573869 AAGGGTAGGGTATGCAGGCTGGG - Intronic
1151512309 17:74568455-74568477 ATGTGTAGTGTGTGTGGTGTGGG + Intergenic
1152622332 17:81371529-81371551 ATGGGGCGTGTATACAGTGAGGG + Intergenic
1156454216 18:37283801-37283823 ATGGGCAGGGTTTGCATTGTGGG + Intronic
1161584481 19:5097755-5097777 CTGGGTACTGGGTGCAGTGTTGG + Intronic
1164492780 19:28729699-28729721 ATGGGTAGCGTATACAGTGTGGG - Intergenic
1164625286 19:29723777-29723799 ATGGGTAATGCATGTAGAGTAGG - Intergenic
1165354776 19:35296809-35296831 ATGTGTAGTGTGTGGTGTGTGGG - Intronic
1166908606 19:46134023-46134045 AGGGGTAGGGTATGCAGGCTGGG + Intergenic
1168318141 19:55493222-55493244 GTGGGTAGAGGATGCAGTGCAGG + Intronic
1168422414 19:56213320-56213342 TTGGGTAGATTAAGCAGTGTTGG - Intergenic
930950991 2:57144800-57144822 CTGGGTAGGGTCTGCAATGTGGG + Intergenic
932451425 2:71813048-71813070 CTGGGGACTGTATGCAGAGTGGG + Intergenic
932913708 2:75832722-75832744 ATAGGTAGTGCATTGAGTGTGGG + Intergenic
939164051 2:138621243-138621265 AGGGCTAGGGTATGCAGGGTGGG + Intergenic
942472430 2:176274992-176275014 TTGGCAAGTGTATTCAGTGTAGG + Intronic
943666077 2:190609812-190609834 ATGGGGACTGAATGCAGTGCTGG + Intergenic
943716067 2:191152999-191153021 ATGGCTAGTGGCTGCCGTGTTGG + Intergenic
943730084 2:191293263-191293285 ATGGGAAGTGCATGCAGGGATGG + Intronic
945150563 2:206785788-206785810 ATGGGTAGGGGAAGAAGTGTTGG - Intronic
945485790 2:210394414-210394436 ATGACTACTGAATGCAGTGTGGG - Intergenic
948569508 2:238909055-238909077 ATGTGGTGTGTATGTAGTGTGGG + Intronic
1171334181 20:24368510-24368532 CTGGGTGGTCTATGCAGTGCTGG - Intergenic
1173234339 20:41230467-41230489 ATGGCTAGTGGCTGCTGTGTTGG - Intronic
1174805028 20:53597876-53597898 ATGAGTTGTGTTTGCAGTGGGGG - Intronic
1184421250 22:44384110-44384132 ACAGTTAGTGTATGCAGGGTGGG + Intergenic
950753946 3:15156386-15156408 ATGTGTGGTGTATGCAGTGTGGG + Intergenic
952276250 3:31880084-31880106 ATGGGTACTGGGTGAAGTGTGGG - Intronic
953089547 3:39710682-39710704 ATGGGAATTCTATACAGTGTAGG - Intergenic
956374333 3:68598171-68598193 ATGGGTAATGTTGGCATTGTTGG + Intergenic
957571545 3:81953068-81953090 ATGGGTAGTGATTGCAGTGCAGG - Intergenic
957727189 3:84082876-84082898 GTGGGTAGTGTATACAGCATAGG + Intergenic
957736421 3:84209898-84209920 ATGGTTAGTGTTGGCATTGTGGG - Intergenic
959380537 3:105636118-105636140 ATGGAGAGTGTATGCAATGGAGG + Intergenic
960022319 3:112968827-112968849 AGGGGTAGAGTTTGCAGTTTGGG + Intronic
961184699 3:124904479-124904501 ATGGCTAATGTCTTCAGTGTGGG + Intergenic
964218762 3:154320473-154320495 ATGGGTAGTAGTTGGAGTGTGGG - Intronic
969657844 4:8508382-8508404 ATGGGTTGTGTCTGTTGTGTGGG + Intergenic
973206223 4:47563460-47563482 CTGGGCAGTTTATGTAGTGTAGG + Intronic
973247204 4:48022193-48022215 ATGGGTAATGGATGGTGTGTGGG - Intronic
975721867 4:77255947-77255969 ATGGGTAATGTGGGCTGTGTAGG + Intronic
977576290 4:98677711-98677733 ATGGGTTGGGTATGAAGGGTGGG + Intergenic
979545490 4:121935314-121935336 ATGAGTAGGGTATGATGTGTAGG + Intronic
982471172 4:155791816-155791838 ATGCATATTGTATGCACTGTTGG + Intronic
982750905 4:159160480-159160502 ATGGATATTGTTGGCAGTGTTGG + Intronic
987231427 5:15897626-15897648 ATGAGTAGTGTCTGAAGGGTGGG + Intronic
988122919 5:26991256-26991278 AATTGTAGTGTATGGAGTGTGGG - Intronic
998761295 5:145434878-145434900 ATGAGAGGTGTATGCAGTGGGGG + Intergenic
998775197 5:145591972-145591994 ATGGATAGTGTATGGAATGTAGG - Intronic
999437580 5:151575335-151575357 TTGGGTAGAGTATGCAGTACTGG + Intergenic
999704222 5:154256817-154256839 ATGGGGTGTGCATGCACTGTTGG - Intronic
1000140712 5:158400728-158400750 ATGGGTAATGAATGCAGGCTTGG + Intergenic
1002460106 5:179369054-179369076 ATGGGGAGGATATGCAGTGAGGG + Intergenic
1003521170 6:6859967-6859989 ATGGCCAGTGGCTGCAGTGTTGG + Intergenic
1005373038 6:25154774-25154796 AGGGGTAGGGTATGCAGGATGGG - Intergenic
1008310668 6:49968540-49968562 ATGGCTAGTGAATTCAATGTTGG - Intergenic
1009614687 6:65989980-65990002 ATGGGTCTTTTGTGCAGTGTAGG + Intergenic
1010616613 6:78020653-78020675 ATTGGTAGTGCATGCAGAGTCGG - Intergenic
1011793464 6:90926037-90926059 ATCAGTAGTTTATGCAGTATGGG - Intergenic
1013906868 6:115231295-115231317 ATGACTAGTGAATGCAGTTTTGG + Intergenic
1015556407 6:134466050-134466072 ATGCCTAGGTTATGCAGTGTTGG - Intergenic
1019980952 7:4621677-4621699 GTGGATAGTATGTGCAGTGTGGG - Intergenic
1022127016 7:27368367-27368389 ATGTGTTGTGTTTGTAGTGTAGG - Intergenic
1027916651 7:84332378-84332400 ATTGGTGGTGTATCCAGTGATGG - Intronic
1029724549 7:102393761-102393783 AGGGGTAGGGTATGCAGGCTGGG - Intronic
1037488501 8:19373859-19373881 ATGGGCACTGTATGCACTGTGGG + Intronic
1039930442 8:41982619-41982641 ATGGGTAGTGTATGCAGTGTGGG - Intronic
1039983155 8:42426303-42426325 ATGTATACTGTATACAGTGTTGG - Intronic
1040658591 8:49543065-49543087 ATGGGTAGTGAATGCATTTCAGG + Intronic
1040898129 8:52389659-52389681 ACTGGTGGTGTATGCAGAGTGGG - Intronic
1043843262 8:85134164-85134186 ATGTGAAGTGTGTGAAGTGTTGG - Intronic
1051900279 9:22031282-22031304 ATGGGTGGTATATGGACTGTAGG - Intronic
1053041327 9:34875691-34875713 ATGTGGAATGTATGCAGTGAAGG + Intergenic
1055777524 9:79782340-79782362 AAGGGAAGGGGATGCAGTGTGGG - Intergenic
1056680193 9:88710625-88710647 AGGGGTGGTGTAGGCAGTGGAGG + Intergenic
1059185165 9:112261964-112261986 ATGGGTAGTGTATGAAGCTTAGG + Intronic
1062303972 9:135891488-135891510 ATGGGTGGTGGCTGCAGTGTTGG - Intronic
1062490639 9:136803345-136803367 CTGGGGATTGTAGGCAGTGTGGG - Intronic
1188108875 X:26173966-26173988 AGTGGTAATGTATGCAGTGAGGG - Intergenic
1194561315 X:95424916-95424938 GAGGGTAGTGTATATAGTGTGGG - Intergenic
1196408621 X:115393180-115393202 ATTGGCAGTGGATGCAGTGGTGG + Intergenic
1197343795 X:125306942-125306964 ATGTGTAGTTTATGCTGTCTAGG + Intergenic