ID: 1039930443

View in Genome Browser
Species Human (GRCh38)
Location 8:41982620-41982642
Sequence AATGGGTAGTGTATGCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039930443_1039930448 3 Left 1039930443 8:41982620-41982642 CCACACTGCATACACTACCCATT 0: 1
1: 0
2: 4
3: 26
4: 205
Right 1039930448 8:41982646-41982668 TAGTCACTTAGTGGTTGTCTGGG No data
1039930443_1039930447 2 Left 1039930443 8:41982620-41982642 CCACACTGCATACACTACCCATT 0: 1
1: 0
2: 4
3: 26
4: 205
Right 1039930447 8:41982645-41982667 TTAGTCACTTAGTGGTTGTCTGG No data
1039930443_1039930449 21 Left 1039930443 8:41982620-41982642 CCACACTGCATACACTACCCATT 0: 1
1: 0
2: 4
3: 26
4: 205
Right 1039930449 8:41982664-41982686 CTGGGTTATCAGACTGTTGCTGG No data
1039930443_1039930445 -6 Left 1039930443 8:41982620-41982642 CCACACTGCATACACTACCCATT 0: 1
1: 0
2: 4
3: 26
4: 205
Right 1039930445 8:41982637-41982659 CCCATTTGTTAGTCACTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039930443 Original CRISPR AATGGGTAGTGTATGCAGTG TGG (reversed) Intronic
900723152 1:4193593-4193615 GATGGGTAATGTAAGCAGAGAGG - Intergenic
902155838 1:14485563-14485585 AAGGGGCAGTTTATGCAGGGTGG - Intergenic
902387969 1:16086821-16086843 AGCGGTAAGTGTATGCAGTGTGG - Intergenic
904668570 1:32144233-32144255 AACTGGCAGTGTATACAGTGTGG + Intronic
908669041 1:66525219-66525241 AATGATTTGTGTTTGCAGTGTGG - Intergenic
911490499 1:98559483-98559505 GGTGGGTAGCATATGCAGTGTGG + Intergenic
914849815 1:151306003-151306025 AATGAGTGGTGTAGGTAGTGAGG - Intronic
916319587 1:163488917-163488939 AATGGGTGCTGTATGTTGTGAGG - Intergenic
916841940 1:168609832-168609854 AATGGGTGGGGTATGAAGTGTGG + Intergenic
919472419 1:197995970-197995992 AGTAGGTAGTGCATACAGTGTGG + Intergenic
921069481 1:211647166-211647188 AATTGGTAGTGTATGCTGAATGG - Intergenic
922108047 1:222529513-222529535 AATGGGAAGTCTATGGAATGTGG - Intronic
923247087 1:232143039-232143061 AATGTGGGGTGTATGCAGTATGG + Intergenic
924223845 1:241904698-241904720 AATGGGGAGTGCATGGAGTTTGG - Intergenic
1063010470 10:2017457-2017479 CATGTGTTGTGTTTGCAGTGTGG + Intergenic
1065330883 10:24597765-24597787 GGCGGGTAGTGTATACAGTGTGG - Intronic
1065961947 10:30740725-30740747 AAAGGGAAGAGCATGCAGTGGGG - Intergenic
1066056003 10:31680696-31680718 ACTGGGTGGTGTAGACAGTGTGG - Intergenic
1066810359 10:39324501-39324523 ACTGGGTAGAATCTGCAGTGGGG - Intergenic
1071885151 10:89941538-89941560 TATGGGTGGTGTCTGAAGTGAGG + Intergenic
1071888144 10:89972798-89972820 ACTGGGGAGTGTCTGCAGGGTGG + Intergenic
1072306481 10:94112652-94112674 ATTGGATATGGTATGCAGTGGGG + Intronic
1072636306 10:97180671-97180693 AGTGGGGACTGTATGCAGGGCGG - Intronic
1073131730 10:101193357-101193379 AAGGGGTGGAGTGTGCAGTGGGG + Intergenic
1074148146 10:110734997-110735019 GATGGGTGGTGTATACACTGTGG - Intronic
1074921427 10:118017994-118018016 AAGGGGAAGGGTTTGCAGTGCGG + Intronic
1075266539 10:121003745-121003767 AGTGTGTAGTGAATGAAGTGTGG + Intergenic
1076869223 10:133185168-133185190 AGTAGGCAGTGTGTGCAGTGTGG + Intronic
1076869225 10:133185191-133185213 AGTAGGCAGTGTGTGCAGTGTGG + Intronic
1076869227 10:133185214-133185236 AGTAGGCAGTGTGTGCAGTGTGG + Intronic
1076869230 10:133185260-133185282 AGTAGGCAGTGTGTGCAGTGTGG + Intronic
1076869235 10:133185329-133185351 AGTAGGCAGTGTGTGCAGTGTGG + Intronic
1076869241 10:133185398-133185420 AGTAGGCAGTGTGTGCAGTGTGG + Intronic
1076869243 10:133185421-133185443 AGTAGGCAGTGTGTGCAGTGTGG + Intronic
1076869246 10:133185467-133185489 AGTAGGCAGTGTGTGCAGTGTGG + Intronic
1077159608 11:1106652-1106674 AATGGGTGGTGAATGGAGGGAGG - Intergenic
1077269804 11:1670513-1670535 TGTGGGTAGTGTGGGCAGTGTGG + Intergenic
1077269808 11:1670531-1670553 TGTGGGTAGTGTGGGCAGTGTGG + Intergenic
1077269812 11:1670549-1670571 TGTGGGTAGTGTGGGCAGTGTGG + Intergenic
1077269821 11:1670594-1670616 TGTGGGTAGTGTGGGCAGTGTGG + Intergenic
1077269825 11:1670612-1670634 TGTGGGTAGTGTGGGCAGTGTGG + Intergenic
1077269845 11:1670720-1670742 TGTGGGTAGTGTGGGCAGTGTGG + Intergenic
1077269919 11:1671080-1671102 TGTGGGTAGTGTGGGCAGTGTGG + Intergenic
1079061935 11:17256586-17256608 AATGGGTAGTGTATATAGCATGG + Intronic
1082189192 11:49221921-49221943 AAAGGGTAGTGTAGGCTTTGAGG - Intergenic
1082901999 11:58265359-58265381 GATGGGTAGTGTATTCAATGTGG + Intergenic
1083176305 11:60952089-60952111 AGAGGGGAGTGTAGGCAGTGGGG - Intronic
1083366933 11:62147034-62147056 AATGGGCAGTGTATTCAGGTGGG - Intronic
1083568841 11:63744503-63744525 ATTGGATACTGTAGGCAGTGTGG + Intronic
1085561446 11:77475493-77475515 AAAGGCTAGTGTAAGCAGTCAGG - Intergenic
1086677326 11:89624744-89624766 AAAGGGTAGTGTAGGCTTTGAGG + Intergenic
1087471539 11:98581618-98581640 AATGGTAAGTATAAGCAGTGTGG + Intergenic
1089074862 11:115729643-115729665 ATGGGGTTGAGTATGCAGTGAGG + Intergenic
1089343370 11:117774661-117774683 AATGTGTACTGTAGGCAGTGAGG - Intronic
1089348338 11:117806275-117806297 AATGGGAAGGATATGCAGAGAGG + Intronic
1090496916 11:127222210-127222232 AATGGGCAGGGAATGGAGTGTGG - Intergenic
1091971715 12:4793048-4793070 ACGGTGTAGGGTATGCAGTGTGG + Intronic
1092026686 12:5246640-5246662 ATGGGGAAGTGTATGCAGTCAGG - Intergenic
1095461463 12:42448949-42448971 GGTGGGTAGTGTATACAGTGTGG - Intronic
1098381409 12:69873602-69873624 GGTGGGTAGTGGATACAGTGTGG + Intronic
1099308717 12:80991152-80991174 AATGGGTAGTGAATGCTATAGGG + Intronic
1101143178 12:101817041-101817063 AAAGGGTAGTGGGGGCAGTGGGG + Intronic
1103126837 12:118430784-118430806 GATGGGTAGTGTCTACAGTGTGG - Intergenic
1103879582 12:124155694-124155716 GGTGGGTAGTGTCTACAGTGTGG + Intronic
1105621674 13:22073619-22073641 GGTGGGTGGTGCATGCAGTGTGG + Intergenic
1107814454 13:44231937-44231959 AAAGGGTGGGGTAGGCAGTGTGG - Intergenic
1108034285 13:46272106-46272128 AATGGGTAGCGTCTACAATGTGG + Intronic
1108044238 13:46367828-46367850 GGTGGGTAGTATATACAGTGTGG - Intronic
1108193527 13:47968128-47968150 CTGGGTTAGTGTATGCAGTGTGG - Intronic
1108891527 13:55266425-55266447 AATGGGTAGTATACACAGTACGG - Intergenic
1109473956 13:62853110-62853132 GATGGGTGGGATATGCAGTGTGG + Intergenic
1109674067 13:65650271-65650293 AATGTGTAGTGTATGAAATTGGG + Intergenic
1111065536 13:83087231-83087253 AAGGGGTATTTTATACAGTGTGG - Intergenic
1111187567 13:84759434-84759456 GATGGGTAGTGCATACAGTGTGG - Intergenic
1112746793 13:102535896-102535918 AATGTGTAAAGTATTCAGTGTGG - Intergenic
1116380507 14:44261910-44261932 AATGGGGAGTGTATGCTGATTGG + Intergenic
1117199850 14:53378312-53378334 CGTGGGTAGTGTATACAGTGTGG + Intergenic
1118152647 14:63206227-63206249 AATGGATACTGTATTCACTGTGG - Intronic
1118548100 14:66917463-66917485 AATGGATAGGTTATGCAGTAAGG - Intronic
1119174752 14:72560884-72560906 AATGGGGAGTGAAAGCAATGGGG + Intronic
1121767108 14:96497373-96497395 GGTGGGCAGTGTATACAGTGTGG - Intergenic
1121804351 14:96803030-96803052 GGTGGGTAGTGTATACAGTGTGG - Intronic
1124821723 15:33052904-33052926 AATGGGTAGTGCATGCTGATTGG - Intronic
1125615207 15:41005224-41005246 AATGGCTACTGTAAGCAATGAGG + Intronic
1127577254 15:60303731-60303753 AATGGGTAGTGGGAGAAGTGGGG - Intergenic
1128833301 15:70788852-70788874 AGCAGGTAGTGTCTGCAGTGTGG - Intergenic
1129934619 15:79438377-79438399 AGTGGGTAGTGTGTGGGGTGTGG + Intronic
1133144225 16:3771683-3771705 GGTGGGTAGTGTCTACAGTGTGG + Intronic
1133543830 16:6786031-6786053 AAATGGTAGTGTCTGCACTGGGG + Intronic
1135165913 16:20139086-20139108 GATGGGTAGTCTCTGCAATGAGG - Intergenic
1139470470 16:67175387-67175409 AATGGGTTGTGTATGCGGGCAGG - Exonic
1139680125 16:68554905-68554927 AGAGGGTAGAGTAGGCAGTGGGG + Intronic
1140583778 16:76262705-76262727 AATGGGTAGAGTATGGTGAGGGG - Intergenic
1140703119 16:77601197-77601219 AATGGGGAGTGCATGCTGAGTGG - Intergenic
1141070631 16:80951444-80951466 TATTGGTAGAGTGTGCAGTGGGG + Intergenic
1143371052 17:6439710-6439732 AATGTGTGGTGTTTGAAGTGAGG - Intergenic
1147615188 17:41823257-41823279 AATGGCTAGGGGATGAAGTGGGG + Intergenic
1150869991 17:68896572-68896594 AGTAGGTAGCATATGCAGTGTGG - Intronic
1150892957 17:69175865-69175887 AATGGGTAACATATACAGTGTGG + Intronic
1152622331 17:81371528-81371550 TATGGGGCGTGTATACAGTGAGG + Intergenic
1152976356 18:223931-223953 AATGGGCAGTATAGACAGTGCGG + Intronic
1155372885 18:25121695-25121717 ACTGGGTAGAGTATGCAGAAGGG + Intronic
1156042844 18:32843026-32843048 AATGGGGAGTGTATGCTGATTGG + Intergenic
1156785739 18:40912075-40912097 CGTGGGTAGTATAGGCAGTGTGG - Intergenic
1159901144 18:74046923-74046945 AATGGGTAATTTCTGCTGTGAGG - Intergenic
1160612764 18:80101414-80101436 TATGGGTAGTGAAGGCAGTGTGG - Intergenic
1162272879 19:9630611-9630633 GATGGGTTGTGTTTACAGTGAGG - Intronic
1163304068 19:16466429-16466451 AATGTGTAGTGCATTCGGTGGGG - Intronic
1164487879 19:28676962-28676984 TATAGGTATTGTATACAGTGTGG - Intergenic
1164492781 19:28729700-28729722 GATGGGTAGCGTATACAGTGTGG - Intergenic
1165802754 19:38562932-38562954 ATGGGGGTGTGTATGCAGTGGGG - Intronic
1166400298 19:42473829-42473851 AAAGGGGAGGGTAGGCAGTGAGG + Intergenic
1168488876 19:56790497-56790519 AAGGGGTAGTGTATACAGAGTGG - Intronic
925220260 2:2133758-2133780 AAAGGGAAATGTTTGCAGTGAGG + Intronic
926554394 2:14340894-14340916 AGCGAGTAGTGTATACAGTGTGG - Intergenic
928618379 2:33062812-33062834 TGTGGGTAGTATGTGCAGTGTGG + Intronic
929639311 2:43560486-43560508 CATGGGTAAAGTATGAAGTGTGG - Intronic
930950990 2:57144799-57144821 ACTGGGTAGGGTCTGCAATGTGG + Intergenic
931910408 2:66893304-66893326 GATTGTTAGTGTTTGCAGTGTGG + Intergenic
932254630 2:70273992-70274014 AATGGGAAGTGTATTCAGGTTGG + Intronic
933573994 2:84045950-84045972 CATGGGTAACGTAAGCAGTGAGG + Intergenic
933595593 2:84280005-84280027 AGTGTGTGATGTATGCAGTGGGG + Intergenic
933784825 2:85830236-85830258 ACTGGGCAGTGTAGGAAGTGAGG + Intergenic
935417187 2:102831414-102831436 CATCGGTCGTGTATGCAGGGTGG - Intronic
936635878 2:114257287-114257309 ATGGGGTAGTATATGCAGTTAGG + Intergenic
937211165 2:120272311-120272333 AATTGTTAGTGAATTCAGTGGGG + Intronic
943174851 2:184457673-184457695 GATGGGTAATGTAAACAGTGAGG + Intergenic
944507162 2:200424717-200424739 AATGGGAATTGTGTCCAGTGGGG - Intronic
948783786 2:240340531-240340553 AGTGGGTAGTGCATGCAGTGGGG - Intergenic
1170531484 20:17297111-17297133 ACAGGGTATTGTATGCAGTGGGG + Intronic
1171052612 20:21874025-21874047 AATGGGAAGTGGATGGAGAGGGG + Intergenic
1174760183 20:53199657-53199679 AATGGGGAGATTATCCAGTGGGG - Intronic
1174805029 20:53597877-53597899 CATGAGTTGTGTTTGCAGTGGGG - Intronic
1175420561 20:58829876-58829898 AATGGTGAATGCATGCAGTGAGG - Intergenic
1175612072 20:60359934-60359956 CGTGGGTAGTGTATACAGTGTGG + Intergenic
1177012684 21:15747668-15747690 AGTGGGTAGTATACACAGTGTGG + Intronic
1178606712 21:34043494-34043516 AGCAGGTAGTGTATGCAGTATGG + Intergenic
1181545364 22:23599358-23599380 AATGGGCAGAGGATGCAGGGAGG - Intergenic
1183160252 22:36108544-36108566 AATAGGTAGGGTAGGCAGGGAGG + Intergenic
1183483269 22:38076212-38076234 CATGGGGAGTGTCTGCAGAGTGG + Intergenic
950438894 3:12995841-12995863 GAAGGGTAGAATATGCAGTGGGG - Intronic
950753945 3:15156385-15156407 CATGTGTGGTGTATGCAGTGTGG + Intergenic
951017638 3:17747336-17747358 ACTTGGTAGTGGATCCAGTGGGG - Intronic
954457002 3:50605123-50605145 GATGGGTAGTGGATACAGAGGGG - Intergenic
954578752 3:51691608-51691630 CATGGCTTGTGTATCCAGTGAGG + Intronic
955029465 3:55202227-55202249 AGTGGGTGGTGGTTGCAGTGGGG + Intergenic
955579658 3:60405336-60405358 AATGGGGAGTGCATGCTGAGTGG - Intronic
957147462 3:76442742-76442764 AGTGGGTAGTACATACAGTGTGG - Intronic
957736422 3:84209899-84209921 AATGGTTAGTGTTGGCATTGTGG - Intergenic
959003435 3:100991529-100991551 AATGGGTAGAGTTTGGGGTGAGG - Intronic
959938844 3:112059402-112059424 AAGGGGGAGAGTATGCAATGGGG - Intronic
960022318 3:112968826-112968848 AAGGGGTAGAGTTTGCAGTTTGG + Intronic
960944762 3:122958393-122958415 AATGTGTACTGTCTGCAGTTTGG + Intronic
960947358 3:122975840-122975862 ATTTGGTTGTGTAGGCAGTGGGG - Intronic
963076743 3:141354357-141354379 AATGGGGAATGCATGGAGTGTGG - Intronic
964440651 3:156705334-156705356 AATTGCTAGTGTACTCAGTGTGG + Exonic
965000417 3:162945821-162945843 GGTGAGTAGTGTATACAGTGTGG + Intergenic
967654318 3:192028085-192028107 GATGGGTAATGTAAGCAGAGAGG + Intergenic
975618611 4:76273154-76273176 GGTGGGTAGTGTGTACAGTGTGG + Intronic
975846396 4:78529729-78529751 AATGGGTAGCATATACAATGTGG + Intronic
977867691 4:102049582-102049604 AAAGGGTAGTGTAGGCAGCTAGG + Intronic
978506740 4:109465834-109465856 AATGGGTCCTGTAGGCAGAGAGG + Intronic
979036062 4:115720106-115720128 GATGGGCAGTGTAAGCAGAGGGG - Intergenic
979933410 4:126661476-126661498 AGTGGGTAGTGTCAGCAGTGTGG - Intergenic
980763447 4:137267171-137267193 AGTGGGTAGTGTGTGCAGCTTGG + Intergenic
981901397 4:149869402-149869424 AGCTGGTAGTGTATGAAGTGTGG + Intergenic
982910457 4:161135466-161135488 AATGTTTAATATATGCAGTGGGG - Intergenic
984499721 4:180544485-180544507 GGTGGGTAGTGTCTACAGTGTGG - Intergenic
988122920 5:26991257-26991279 AAATTGTAGTGTATGGAGTGTGG - Intronic
988274268 5:29060165-29060187 AATAGATAGTGTATTCAGTTAGG + Intergenic
990719988 5:58683766-58683788 GGAGGGTAGTGTATGCAGTGTGG - Intronic
991397145 5:66216191-66216213 GATGGGTAGTGTAGACAGTGTGG + Intergenic
992746040 5:79821500-79821522 ACAGGGTTGTGTACGCAGTGAGG - Intergenic
995322484 5:110852135-110852157 AATGTTTAATGTATTCAGTGAGG + Intergenic
995988189 5:118206363-118206385 AATGGGGAGGGTAGGCAATGGGG - Intergenic
997514828 5:134480020-134480042 GATGGGCAGTGTATACAGTGTGG + Intergenic
998761294 5:145434877-145434899 GATGAGAGGTGTATGCAGTGGGG + Intergenic
1000972339 5:167728156-167728178 AAGGGGTAGGGGATGAAGTGGGG - Intronic
1002460105 5:179369053-179369075 CATGGGGAGGATATGCAGTGAGG + Intergenic
1003408826 6:5845532-5845554 ATTGGGTAGGATATGGAGTGAGG - Intergenic
1005128948 6:22480699-22480721 AATGGGTAATGTATGCAGGTGGG + Intergenic
1008149980 6:47938583-47938605 AGTGGGTAGTGAATGGACTGGGG + Intronic
1008688053 6:53945962-53945984 GCTGGGGTGTGTATGCAGTGGGG + Intronic
1011438006 6:87359180-87359202 TATGGGTGGGGTATGTAGTGAGG + Intronic
1011793465 6:90926038-90926060 AATCAGTAGTTTATGCAGTATGG - Intergenic
1012103997 6:95129461-95129483 AATGGGGAGTGGGTGCAGTGGGG - Intergenic
1013207259 6:107956537-107956559 AATGGGTAGTTTATGAAATTTGG - Intronic
1013771655 6:113634620-113634642 AATGGGAAGTGAATTGAGTGGGG - Intergenic
1018769623 6:166959198-166959220 AATGGGTAGGGGGTGGAGTGAGG + Intergenic
1018978772 6:168585363-168585385 AATGGGTAATGCACGCAGTGAGG - Intronic
1020578438 7:9963943-9963965 AATGGGAAGAGAATGCAGGGCGG - Intergenic
1020769417 7:12369595-12369617 AATGGGCAGTGCATGGAATGGGG - Exonic
1021285635 7:18777875-18777897 AATGGCTAGTCTCTGCTGTGAGG - Intronic
1021885569 7:25134787-25134809 AATTGGGAGTGTCTGAAGTGAGG - Exonic
1027606690 7:80308865-80308887 AATATGTACTGTATGCAGTTGGG - Intergenic
1029208451 7:98884619-98884641 AATGGGGAGTGTCTCCAGTGAGG - Intronic
1030919701 7:115366948-115366970 GATGGGTAGTGTATACAGTATGG + Intergenic
1030943308 7:115682503-115682525 AATGGGTAGAGTGGGAAGTGAGG - Intergenic
1033953555 7:146815596-146815618 ATTGGGTAGAATATGGAGTGAGG + Intronic
1037488500 8:19373858-19373880 CATGGGCACTGTATGCACTGTGG + Intronic
1038745399 8:30250096-30250118 AATGGGTAGTGGCGGCTGTGGGG + Intergenic
1039930443 8:41982620-41982642 AATGGGTAGTGTATGCAGTGTGG - Intronic
1040407309 8:47118207-47118229 AATGGGAAGAGTAAGCAGGGAGG + Intergenic
1041804957 8:61839857-61839879 AATGGGTAATGTAAGTAGAGAGG - Intergenic
1042357246 8:67841695-67841717 AATGTGTACTGTATTCAGTTAGG + Intergenic
1043618655 8:82160170-82160192 GGTGGGTAGTGTAGACAGTGAGG + Intergenic
1043739752 8:83796062-83796084 GAAGGGTAGTGTATGGAGAGGGG - Intergenic
1046254880 8:111682737-111682759 GGTGGGTAGTGTATTCAGTATGG + Intergenic
1046406225 8:113776053-113776075 AATGGGTAGTGCATGCTGATTGG - Intergenic
1047036645 8:120946932-120946954 AGTTGGTAGTGGTTGCAGTGTGG + Intergenic
1047572920 8:126120650-126120672 AGTAGGTAGTATATACAGTGTGG + Intergenic
1048441272 8:134460957-134460979 TATGTGTAGTGTGTGCAGTGTGG + Intergenic
1048441283 8:134461155-134461177 TATGTGTAGTGTGTGCGGTGTGG + Intergenic
1049132429 8:140859278-140859300 AAAGGGCAGTGTGTACAGTGAGG + Intronic
1050127916 9:2378695-2378717 AATGGATAGTGTGTTCAGTTGGG + Intergenic
1050960708 9:11726698-11726720 AATGAGTAGTGTATTGAGGGTGG + Intergenic
1052963089 9:34317655-34317677 AGTGGGTAGTTTATGCAGTGTGG - Intronic
1055851455 9:80635740-80635762 GATGGGTAATGTAAGCAGAGAGG - Intergenic
1056231382 9:84548142-84548164 TATGTGTATTGTATGAAGTGTGG - Intergenic
1061131725 9:128712350-128712372 AAAGGGTAGAGAAAGCAGTGGGG - Intronic
1061440795 9:130602146-130602168 AGTGGGTAGTGTATACAGTGTGG - Intronic
1062447381 9:136600735-136600757 ACTGAGGAGTGTATGCACTGAGG + Intergenic
1187140153 X:16585626-16585648 CATGGGTAGGGTATGCAGGCTGG + Intergenic
1187726985 X:22213541-22213563 AATTGGTAGTGTATGGACTTAGG + Intronic
1188108876 X:26173967-26173989 TAGTGGTAATGTATGCAGTGAGG - Intergenic
1188478770 X:30615429-30615451 AGTGGGTAGTGTATACAGCGTGG - Intergenic
1188557337 X:31427642-31427664 AATGTTTAGTTTTTGCAGTGTGG + Intronic
1188893856 X:35643111-35643133 AATGGGGAGTGTATGCTGGCTGG - Intergenic
1189450815 X:41128285-41128307 AATGGGAAATGTAAGCAGAGAGG + Intronic
1192360877 X:70438418-70438440 GGTGGGTAGTGTATGCAGTGTGG + Intergenic
1194464414 X:94214824-94214846 AATGGGTACTGTATCCATAGAGG + Intergenic
1194488261 X:94513717-94513739 AGTGGGTAGTGTATACAGCATGG - Intergenic
1194561316 X:95424917-95424939 AGAGGGTAGTGTATATAGTGTGG - Intergenic
1196913807 X:120511684-120511706 AATGGGTGGTATATACAGTATGG - Intergenic
1197627498 X:128818890-128818912 GATGGGTAGTGTTTACAGTGTGG - Intergenic
1197804601 X:130386738-130386760 AAAGGTTAGTGTTTGAAGTGAGG + Intergenic