ID: 1039930444

View in Genome Browser
Species Human (GRCh38)
Location 8:41982637-41982659
Sequence CCACTAAGTGACTAACAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 3, 2: 3, 3: 42, 4: 231}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039930444_1039930449 4 Left 1039930444 8:41982637-41982659 CCCATTTGTTAGTCACTTAGTGG 0: 1
1: 3
2: 3
3: 42
4: 231
Right 1039930449 8:41982664-41982686 CTGGGTTATCAGACTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039930444 Original CRISPR CCACTAAGTGACTAACAAAT GGG (reversed) Intronic
904444697 1:30559572-30559594 CTACTAAGTGACTAAAAGGTGGG + Intergenic
904692840 1:32307501-32307523 CTACTAAGTGACTCACAGGTGGG + Intronic
909388153 1:75084262-75084284 CTACTAAGTGACTAATAGGTGGG + Intergenic
909458622 1:75880881-75880903 TCACAAAGTGATTAGCAAATGGG + Intronic
911005644 1:93219531-93219553 CTACTAAGTGACTAACGAGCAGG + Intronic
911067583 1:93804529-93804551 CTATTAAGTGACTAACAGACAGG + Intronic
911231000 1:95361705-95361727 CTACTAAGTGACTAGCAGGTGGG - Intergenic
912603877 1:110967494-110967516 CGCCTAAGTGACTAACAGGTGGG - Intergenic
912617296 1:111116093-111116115 CTACAAAGTGACTAATGAATGGG + Intergenic
913488081 1:119352213-119352235 CTGCTAAGTGACTAACAGGTGGG - Intergenic
914984009 1:152441095-152441117 CCACTAACTGAGCAGCAAATAGG + Intergenic
917302464 1:173590718-173590740 CCACTAAGTGACTAACGGGCAGG + Intronic
918656442 1:187031998-187032020 CTACTAAGTGACTAATAGGTAGG - Intergenic
919322700 1:196063169-196063191 CCACTAAGTTATTAAAAAAATGG - Intergenic
919348340 1:196416128-196416150 CTACTAAGTGACTAATGGATGGG - Intronic
919368253 1:196693542-196693564 CTACTAAGTGACTAACAGGCTGG + Intronic
919368265 1:196693639-196693661 CTACTAAGTGACTAACAGGCAGG + Intronic
919381033 1:196861557-196861579 CTACTAAGTGACTAACAGGCGGG + Intronic
921667731 1:217892909-217892931 CTACTGAGTGACTAACAGGTAGG + Intergenic
922010826 1:221584676-221584698 CCACTAAATAAATAACAAAGAGG - Intergenic
922307218 1:224354658-224354680 CTACTACGTGACTAACAGGTAGG - Intergenic
924124206 1:240833211-240833233 CTACTAAGTGCCTAACAGGTGGG + Intronic
924478719 1:244406629-244406651 CTACTAAGTGACTAACAGGCAGG - Intergenic
1066757120 10:38722403-38722425 AAACTAATTGACTCACAAATGGG + Intergenic
1067788775 10:49272186-49272208 CCACAAACTGAGGAACAAATGGG + Intergenic
1067789111 10:49274261-49274283 CCACAAACTGAGGAACAAATGGG + Intergenic
1068297107 10:55085714-55085736 AAATTAAGTGAATAACAAATTGG + Intronic
1069080272 10:64081239-64081261 CAACTTAGTGGCTAAGAAATAGG + Intergenic
1070237828 10:74648878-74648900 CCACTAAGAAAATAAGAAATAGG + Intronic
1071009905 10:80925942-80925964 TTGCTAAGTGACTAACAGATGGG - Intergenic
1072267309 10:93743104-93743126 CTACTAAGTGACTAACGGATTGG - Intergenic
1073757640 10:106597939-106597961 CCACAACGTAAGTAACAAATTGG + Intronic
1073845886 10:107554277-107554299 CCACTGAATCTCTAACAAATGGG - Intergenic
1074746350 10:116536987-116537009 TTACCAAGTGACTAACACATAGG + Intergenic
1074951730 10:118343338-118343360 CTACTAAGTGACTAAGAACCTGG - Intergenic
1076133490 10:128029241-128029263 CCACTAAGTCACCAAGAACTAGG - Intronic
1079061934 11:17256569-17256591 CTGCTAAGTGACTAATAAATGGG + Intronic
1080292038 11:30681734-30681756 CTACTAAGTGACTAATGGATAGG - Intergenic
1081358104 11:42138826-42138848 CCAATAAATGAATAACAAAATGG - Intergenic
1082640841 11:55658483-55658505 TCAGTAAGTGAGTAACAAACAGG + Intergenic
1084335618 11:68455884-68455906 CCGCTGAGTTACTAACAACTAGG - Intergenic
1084701390 11:70788507-70788529 CTCCTAAGTGACTAACCAGTGGG - Intronic
1085033683 11:73287726-73287748 CCACAAGGAGACAAACAAATGGG + Intronic
1085977113 11:81670350-81670372 CTACTAAGTGACTAACAAATGGG + Intergenic
1086563488 11:88196627-88196649 CCACTATGTGTCTTACAATTGGG + Intergenic
1089109050 11:116040175-116040197 TCACGAAGTACCTAACAAATTGG - Intergenic
1089437171 11:118479280-118479302 CCACAAACTGACTAAAAAAGAGG - Intronic
1091941538 12:4488197-4488219 CCACTAAGTTACTTATAAACTGG - Exonic
1092452106 12:8612137-8612159 CCATTAACTGCCTAACAATTGGG + Intronic
1093158814 12:15720572-15720594 ACACTTAGTGATCAACAAATGGG + Intronic
1093333774 12:17875431-17875453 CCACCAGGTGACTCAAAAATGGG + Intergenic
1093879128 12:24383609-24383631 CTACTAAGTGACTAACAGGCAGG - Intergenic
1093997488 12:25657620-25657642 CCACTAATTAACTCACTAATGGG + Intergenic
1094208865 12:27869520-27869542 CCAGTAACTGAATTACAAATGGG + Intergenic
1094296004 12:28905736-28905758 CTACTAAGTGACTAATAGATGGG + Intergenic
1095460323 12:42436719-42436741 CTACTAAGTGACTAACAGGTGGG + Intronic
1099698010 12:86045146-86045168 CCACCAAGTGACTGAGACATAGG - Intronic
1100424013 12:94465366-94465388 CTACTAAGTGACTAACAGGTGGG + Intergenic
1101103771 12:101420666-101420688 CTACTAAGTGACTAGCAGGTGGG - Intergenic
1102629178 12:114262104-114262126 CTGCTAAGTGACTAACAGAGGGG + Intergenic
1103171284 12:118822366-118822388 CTACTAAGTGACTGACAGGTGGG + Intergenic
1103686804 12:122738588-122738610 CTACTAAGTGACTACCAGGTCGG + Intergenic
1103879581 12:124155677-124155699 CGACTAAGTGACTGACAGGTGGG + Intronic
1104418709 12:128617279-128617301 CCACCTTGTGACTAACAAAGAGG - Intronic
1105056124 12:133100810-133100832 CTCCTAAGTGACTAACAGGTGGG + Intronic
1105401517 13:20100246-20100268 CTACTAAGTGACTGACAGGTGGG + Intergenic
1106371205 13:29135166-29135188 CTACTAAGTGACTAATAAGTGGG - Intronic
1106710833 13:32330559-32330581 CTACTAAGTGACTAATAGGTGGG + Intronic
1107777928 13:43866031-43866053 CTACTAAGTGACTAATGAATGGG + Intronic
1108731552 13:53240577-53240599 CCACTAAGTCAAGAAGAAATAGG - Intergenic
1108746823 13:53404578-53404600 CAACTAAGTGACCAATTAATAGG - Intergenic
1109688423 13:65851440-65851462 CCAGTATTTGACTAACAATTTGG - Intergenic
1109762459 13:66847755-66847777 CTACTAAGTGACTAACGAGCAGG + Intronic
1110073828 13:71213648-71213670 CTATTAAATGACTAACAAGTAGG - Intergenic
1111666624 13:91277704-91277726 CGACTAAGTGACTAATGAACAGG + Intergenic
1112512572 13:100022906-100022928 CTACTAAGTGATTAACAGGTAGG + Intergenic
1114967611 14:27982738-27982760 CTACTAAGTGACTAACAAGCAGG - Intergenic
1115600613 14:34952354-34952376 CTACTAAGTGACTAACAGGTGGG - Intergenic
1115748844 14:36467535-36467557 TGACTAAGTGACTAACAGACAGG - Intergenic
1116384810 14:44317130-44317152 CCACCAAGTGACTAACGTGTGGG - Intergenic
1116388974 14:44368283-44368305 CTACTTAGTAACTAATAAATTGG - Intergenic
1116697433 14:48194563-48194585 CTTCTAAGGGACTACCAAATAGG + Intergenic
1116727796 14:48584182-48584204 CCACTAAGTGACTAATGAGTGGG + Intergenic
1117397826 14:55328451-55328473 CTACTGAGTGACTAACACATTGG + Intronic
1120717623 14:87856739-87856761 TCACTCAGTCACTATCAAATGGG - Intronic
1122392376 14:101398936-101398958 CTACTAAGTGACTAATGGATGGG + Intergenic
1122521025 14:102343874-102343896 CCACTAAGTGACTTTCCAAGTGG - Intronic
1124214449 15:27795043-27795065 CCACTCGGTGATTAACAAATTGG - Intronic
1124684276 15:31767447-31767469 CCATGAAGTGCCTAGCAAATTGG - Intronic
1126250470 15:46561865-46561887 CCACTTATTGACCAATAAATTGG - Intergenic
1126317755 15:47388532-47388554 CTACTAAGTGACTAACAGGTGGG - Intronic
1126653708 15:50953559-50953581 CTACTAAGTGACTAACAGGCAGG - Intronic
1127577492 15:60305982-60306004 CCACCAAGTGCCTAGCAAAATGG - Intergenic
1133205721 16:4232355-4232377 ACACTAAGTAATCAACAAATTGG + Intronic
1133691761 16:8222403-8222425 CAAATAAGTGACTAAAAATTTGG + Intergenic
1136606221 16:31335829-31335851 CCACAAAGTGACTAATAAACAGG + Intergenic
1137889183 16:52140623-52140645 CTACTATGTGACTAACAGCTGGG - Intergenic
1138790991 16:59903686-59903708 TTACTAAGTGACTAACAGGTTGG - Intergenic
1139975385 16:70806004-70806026 CTACTCAGTGACTATCAAGTAGG - Intergenic
1141376633 16:83536720-83536742 CCACTAGGGGACTACCATATTGG + Intronic
1145882552 17:28363120-28363142 ACTCTATGTGACTAAAAAATGGG - Exonic
1146233677 17:31136600-31136622 CTACTAAGTGACTAACAGGCAGG - Intronic
1146432693 17:32812800-32812822 GCACTAAGTCACTTACAAATAGG + Intronic
1146831729 17:36075519-36075541 AAACTAAGTCACTAACAACTGGG + Intergenic
1149915964 17:60609652-60609674 CTACTAAGTGACTAACAGGTAGG - Intronic
1155750602 18:29418295-29418317 CCACTAAGTGACTAATGGGTGGG + Intergenic
1156075114 18:33266295-33266317 CTACTAAGTGACTAAAACACAGG - Intronic
1156478548 18:37421669-37421691 CCACCAAGTGATAAACAGATCGG + Intronic
1156930013 18:42630180-42630202 CTACTAAGTGACTGACAGACAGG + Intergenic
1157004542 18:43566359-43566381 CTATTAAGTGACTAACAGGTGGG - Intergenic
1157842321 18:50969931-50969953 TCACTAAGTGATTCTCAAATCGG + Intronic
1158147191 18:54328051-54328073 CTACTAAGTGACTAACGGGTGGG - Intronic
1159363942 18:67441631-67441653 CTGCTAAGTGACTAACTAATGGG + Intergenic
1159464392 18:68762447-68762469 CCACTAAGTGACTAGTGAGTGGG - Intronic
1166526815 19:43515912-43515934 CTACTAAGTGATTAACGAATGGG + Intronic
1168528882 19:57110760-57110782 CCATTAAATTACTAACATATAGG + Intergenic
928043568 2:27904055-27904077 CGACTAAGTGACTAACGGGTGGG + Intronic
928555823 2:32423880-32423902 CTACTAAGTGACTAACAGACAGG - Intronic
930267541 2:49217540-49217562 CTGCTAAGTGACTAACAGACAGG + Intergenic
930433009 2:51304646-51304668 CCACTAAGAAAAAAACAAATTGG - Intergenic
930887547 2:56344332-56344354 CCATTAAGTGACTAACAGGCAGG + Intronic
931141689 2:59466023-59466045 CTACTAAGTGACCAACATGTGGG + Intergenic
931328667 2:61255791-61255813 CTACTAAGTGACCAATAAGTGGG - Intronic
933028067 2:77287676-77287698 CTACTAAGTTACTAACAGGTGGG - Intronic
933800513 2:85956733-85956755 CCACTCAGTGAATAGGAAATGGG - Intergenic
936249440 2:110856321-110856343 CTACTAAGTGACTAACGGGTGGG - Intronic
939351147 2:141039180-141039202 CCAGTAAGTGAATAACAGATAGG - Intronic
941248475 2:163131569-163131591 CCACTAAGTGACTAACAGGTGGG - Intergenic
941355449 2:164485734-164485756 CTACTTGGTGACTAACAAGTGGG - Intergenic
942242773 2:173978604-173978626 CTACTGAGTGACTAACAGGTGGG + Intergenic
942336669 2:174894980-174895002 CTACTAAGTGACTAACAGGTGGG - Intronic
943639069 2:190339551-190339573 CTACAAAGTGACTAACAGACAGG + Intronic
943665921 2:190608147-190608169 CTACAAAGTGACTAACGGATGGG - Intergenic
944447878 2:199809923-199809945 ATACTAAGTGACTAAAAAATGGG - Intronic
945056295 2:205872287-205872309 CTACTAACTGACTAACACGTGGG + Intergenic
947557674 2:231110789-231110811 ACAATATGTTACTAACAAATGGG - Intronic
948021713 2:234738693-234738715 ACACTGAGTGAGTATCAAATGGG - Intergenic
1170908657 20:20541520-20541542 CCACTAAGTGACTAATGGCTGGG + Intronic
1172397067 20:34615711-34615733 CTACTAAGTGACTAACAGGCAGG - Intronic
1173785546 20:45790466-45790488 CCACTCAGAAACTATCAAATAGG + Intronic
1176931209 21:14812462-14812484 CAACTAAGTGACTAACAGGTGGG + Intergenic
1178606711 21:34043477-34043499 CTACTAAGTGACTAACAAGCAGG + Intergenic
1178865742 21:36325850-36325872 CTACTAAGTGACTAATAGGTTGG - Intronic
1183998569 22:41655033-41655055 CTACTAAGTGACTAACTGGTGGG - Intronic
952010890 3:28899962-28899984 TTACTAAGTGACTAACAGGTGGG + Intergenic
952058187 3:29474258-29474280 CCACTATGAGAATAACAAACTGG - Intronic
953968216 3:47326552-47326574 CCACTAATTGCCTCACAAACAGG + Intronic
955194965 3:56796692-56796714 CCTCTAAGTGACTAAATCATTGG - Intronic
957033477 3:75270458-75270480 CTATGAAGTGACTAACAGATGGG - Intergenic
959238018 3:103749483-103749505 ATACTAAATGACGAACAAATTGG - Intergenic
962234537 3:133695856-133695878 CTACTAAGTAACTAACAGGTAGG + Intergenic
962288889 3:134113470-134113492 CTACTAAGTGACTAATGAATGGG - Intronic
962426800 3:135277379-135277401 AGACTCAGTGACTAACAAGTTGG - Intergenic
962481559 3:135802664-135802686 CCACCTAGTGACTATCAAACAGG - Intergenic
962760614 3:138509821-138509843 CTACTAAGTGACTAACTGGTAGG - Intronic
963676322 3:148315981-148316003 CTACTAAGTGACTAACTGGTTGG - Intergenic
963710400 3:148740441-148740463 CCTTTAGGTGACTGACAAATTGG - Intronic
965452056 3:168850262-168850284 CTACTAAGTGACTAGCAAGCAGG + Intergenic
966722091 3:183073941-183073963 CTCCTGAGTGACTAACAGATGGG + Intronic
967714511 3:192747094-192747116 CTACCAAGTGACTAACAAGCAGG - Intronic
968465882 4:750611-750633 CCTCAAAGTGCCTCACAAATAGG - Intronic
969607093 4:8207719-8207741 CCACTAAGTGACGAAGACACAGG - Intronic
971016556 4:22495151-22495173 CTACTAAGTGACTAACAGGCAGG + Intronic
971445802 4:26746914-26746936 CTTCTAAGTGACTAACATGTGGG + Intronic
972898357 4:43652476-43652498 TCCCCAAGTGACTAACAATTGGG + Intergenic
973082396 4:46010595-46010617 TTACTAAGTGACCAACAGATGGG + Intergenic
975846395 4:78529712-78529734 CTACTAAGTGACTAACAAATGGG + Intronic
976362769 4:84199535-84199557 CTACTAAGTGACTAACAAGCAGG + Intergenic
976896801 4:90122569-90122591 CTACTAAATGACTAACAAGCAGG - Intergenic
977322871 4:95541325-95541347 CTACTAAGTGACTACCAGGTGGG - Intronic
979011386 4:115374854-115374876 CTACTAAGTGACTAATAAGAGGG - Intergenic
979447629 4:120833320-120833342 CTACCAAGTGACTAATGAATGGG - Intronic
979550267 4:121983123-121983145 CTGCTAAGTGACTAACAGGTGGG + Intergenic
979925935 4:126564124-126564146 CCATTACGTGACAAAGAAATTGG + Intergenic
980050607 4:128035716-128035738 ACTCTAAGTAACTAACAAAAAGG - Intronic
980224762 4:129967644-129967666 GCACTAAGTGACTAATTAATAGG + Intergenic
980245325 4:130231584-130231606 CTACTAAGTGACTAACAGGAAGG + Intergenic
980929551 4:139172459-139172481 CCACTAAGTGACTAATGAGCAGG - Intronic
981817287 4:148845359-148845381 CCTCCTAGTTACTAACAAATGGG - Intergenic
981974078 4:150702200-150702222 CCACTAAATGAGAAACAAAATGG + Intronic
984210427 4:176840470-176840492 TCACTAAGTGACTAACAGACAGG - Intergenic
985032381 4:185802562-185802584 ACACTAACATACTAACAAATGGG + Intronic
986529230 5:8717360-8717382 CTACTAAGTGACTAACAGTCAGG + Intergenic
986622821 5:9693140-9693162 CCCCAAAGTGAAAAACAAATAGG + Intronic
987646495 5:20679241-20679263 CTACTAAGTGACTCACAAGGAGG - Intergenic
987844846 5:23270135-23270157 CTACTAAGTGACTAACGAGCTGG + Intergenic
988903221 5:35756216-35756238 CTACTAAGTGACTAACAGATGGG - Intronic
991240799 5:64458011-64458033 CTACTAAGTGACTAACAGGTAGG + Intergenic
992213881 5:74506899-74506921 CCAGTCAGTGACTAACAGTTGGG + Intergenic
992822975 5:80517055-80517077 CTATTAAGTGACTAACAGGTGGG - Intronic
993092255 5:83440898-83440920 CTACTAAGTGACTAACAGGCAGG + Intergenic
993468925 5:88282849-88282871 CTACTAAGTGACTAACAGGTGGG + Intergenic
994834675 5:104834254-104834276 CCACTAATATACTAAAAAATAGG - Intergenic
994909205 5:105880790-105880812 GCACTAAGTGACTAGCAGGTGGG - Intergenic
996945497 5:129062241-129062263 CTGCTAAGTGACTAACAGGTGGG + Intergenic
996963470 5:129279731-129279753 CCACTCAGTGCCTAAGAAAAGGG + Intergenic
997514827 5:134480003-134480025 CTTCTAAGTGACTAACAGATGGG + Intergenic
998653229 5:144144647-144144669 CCACTAAGGGACAATCAAAAAGG + Intergenic
999346250 5:150822195-150822217 CTACTAAGTGACTAACAGGCAGG + Intergenic
1000020849 5:157318230-157318252 CCACCAAATAACTGACAAATTGG - Intronic
1000894464 5:166838780-166838802 CTACTAAGTGACTAACAGGTGGG - Intergenic
1001815189 5:174662690-174662712 CTACTAAGTGACTAACAGGTAGG - Intergenic
1001981705 5:176042470-176042492 CTGCTAAGTGACTAACAAGTGGG - Intergenic
1002037596 5:176484429-176484451 CTACTAACTGACTAACAGGTGGG - Intronic
1002153061 5:177252007-177252029 CTACCAAGTGAATAATAAATGGG + Intronic
1002235761 5:177801590-177801612 CTGCTAAGTGACTAACAAGTGGG + Intergenic
1003588373 6:7414962-7414984 CTACTAAGTGACTAACGGGTGGG - Intronic
1004827456 6:19438637-19438659 CCACTAAGTGACCAACTGCTTGG + Intergenic
1005149891 6:22736706-22736728 CCAGAAAGTGCCTACCAAATAGG + Intergenic
1008554321 6:52660099-52660121 CTACTAAGTGACTAAACAAAAGG - Intergenic
1009396924 6:63210960-63210982 CTACTGAGTGACTAACAGACAGG - Intergenic
1009885110 6:69616343-69616365 TCACTAAGTCAGTAACAAAACGG + Intergenic
1009988551 6:70811940-70811962 CTACTGAGTGACTAACAGGTGGG + Intronic
1010841846 6:80655647-80655669 CTACTAAGTGACTAACAGGTGGG + Intergenic
1011223233 6:85080011-85080033 CTAGTAAGTGACTAACATGTGGG - Intergenic
1011498077 6:87956445-87956467 CTACTAAATGACTAACAAGCAGG + Intergenic
1012164837 6:95935900-95935922 CTACTAAGTGACTAATGGATGGG + Intergenic
1012242888 6:96894267-96894289 CTACTAAGTGACTAACAGGCAGG - Intronic
1012864484 6:104601610-104601632 CCAAAACGTGATTAACAAATTGG + Intergenic
1013253128 6:108354632-108354654 CCACTAAGTGACCAACGAGAGGG + Intronic
1013489160 6:110628542-110628564 CCACTAAGTGACTAACCAGTGGG - Intronic
1014510377 6:122313792-122313814 CTACTAAGTGACTATCAGGTGGG + Intergenic
1015363484 6:132369684-132369706 CTACTAAGTGACTAACGGATGGG + Intronic
1016758247 6:147710513-147710535 CCACCAAGTAACTAACAAGCAGG - Intronic
1018693958 6:166375163-166375185 TGACTAAGTGACTAACAAGTAGG + Intronic
1019029201 6:168995620-168995642 ACACTGAGTGGCCAACAAATGGG + Intergenic
1020553250 7:9634984-9635006 ACCCTAAGTGACTAACAATCAGG - Intergenic
1021981130 7:26056811-26056833 CTACTAAGTGCCTAGCAGATGGG - Intergenic
1022075545 7:26965835-26965857 CTACTAAGTGACTAACAGGCAGG + Intronic
1022501819 7:30886615-30886637 CCACTAAGTGACCTTCCAATGGG - Intronic
1023164585 7:37330939-37330961 CTACTAAGTGACTAACAAATGGG + Intronic
1023302214 7:38784863-38784885 CCAATAAGGGAATAAGAAATGGG - Intronic
1023678791 7:42661454-42661476 CAGCTAAGTGACTAACAAGTGGG + Intergenic
1026407164 7:70078253-70078275 CTACTAAGTGACTAACAGGCAGG + Intronic
1028102374 7:86837105-86837127 ACAATAAGTGAATAATAAATTGG + Intronic
1028106945 7:86889501-86889523 CTACTAAGTAACTAACAAGCAGG + Intronic
1028133844 7:87206555-87206577 CTACTAAGTGACTAACAGGCAGG + Intronic
1028300108 7:89188453-89188475 CCTCTAAGTGTTTAAGAAATAGG + Intronic
1030919700 7:115366931-115366953 CTACTCAGTGACTAACAGATGGG + Intergenic
1030983530 7:116213021-116213043 CTATTAAGGGACTCACAAATTGG - Intronic
1031230409 7:119098476-119098498 AAACAAAGTGACTAAAAAATGGG - Intergenic
1032679806 7:134170123-134170145 AAACTAAGTGTCTAACAAACAGG - Intronic
1034608692 7:152344318-152344340 CTACTAAGTGACTAACAGGCAGG + Intronic
1036613153 8:10367181-10367203 TCTTTAAGTGACTAACAGATAGG - Intronic
1037266698 8:17070895-17070917 CTACTAAGTGCCTAACAGGTGGG + Intronic
1038949876 8:32402561-32402583 CTACTGAGTGACTAACAGGTCGG - Intronic
1039930444 8:41982637-41982659 CCACTAAGTGACTAACAAATGGG - Intronic
1040040791 8:42915101-42915123 CCACCCAGTGACTAACAAACAGG - Intronic
1042223729 8:66498648-66498670 CTACTAAGCGACTAACAGGTGGG + Intronic
1042400682 8:68342705-68342727 CTACTAAGTGACTGACAGGTGGG - Intronic
1043618654 8:82160153-82160175 CTACTAAGTGACTAATAGGTGGG + Intergenic
1043713742 8:83453766-83453788 CTACTAAGTGACTAACAGGCAGG + Intergenic
1043931400 8:86095437-86095459 CTACTAAGTGACTCACAAGCAGG + Intronic
1044074514 8:87802555-87802577 CTACTAAGTGACTAATGAGTGGG + Intergenic
1045634126 8:104163327-104163349 CCACTGAGTGACAAACAATATGG + Intronic
1046857813 8:119054100-119054122 CTACTAAGTGACTAACGACCAGG + Intronic
1047047299 8:121069066-121069088 CCACTAAGAAAATAACAAAAAGG + Intergenic
1047680178 8:127246665-127246687 CCACTAGGTCACTTAAAAATAGG + Intergenic
1048153575 8:131918889-131918911 CCTCTAAGTAATTCACAAATAGG - Intronic
1049140930 8:140953458-140953480 CTACTAAGTGACTAACAGGCGGG + Intronic
1050701660 9:8346602-8346624 CTACTAAGTGACTAACAGGCAGG - Intronic
1050766311 9:9139560-9139582 CTACTAAGTGACTCAGGAATGGG + Intronic
1051137822 9:13942954-13942976 CTACTGAGTGACTCACAAGTGGG - Intergenic
1052462946 9:28790197-28790219 CTACTAAATGACTAACAGACAGG - Intergenic
1052963090 9:34317672-34317694 CTACTAAGTGACTAATGAGTGGG - Intronic
1053824580 9:42008739-42008761 CCACTAAGGGACCAAAAAAGTGG + Intronic
1054605991 9:67178624-67178646 CCACTAAGGGACCAAAAAAGTGG - Intergenic
1056198374 9:84250707-84250729 CCACTAAGTGCCTGACATGTTGG - Intergenic
1057451777 9:95168939-95168961 CTACTAAGTGACTAACGAGCAGG - Intronic
1058514753 9:105759073-105759095 CCATGAAGTGCCTAGCAAATTGG + Intronic
1059110479 9:111554593-111554615 CTACTAAGTGACTAACAGACAGG + Intronic
1059132119 9:111764170-111764192 CTACTAAGTGACAAATGAATAGG - Intronic
1059579576 9:115529789-115529811 CTGCTAAGTGACTAACAGGTGGG + Intergenic
1188760225 X:34018713-34018735 CTACTAAGTGACTAACAGGCAGG + Intergenic
1189129515 X:38483870-38483892 CCAAGAAATGAATAACAAATGGG + Intronic
1192252655 X:69425600-69425622 CCACTAAGCTACTATCAACTAGG + Intergenic
1193365607 X:80628703-80628725 CTACTAAGTAACTAATAAGTGGG - Intergenic
1193532798 X:82676666-82676688 ACACTAAGTGCCTAAGAACTAGG + Intergenic
1194488262 X:94513734-94513756 CCACAAAGTGACTAATGAGTGGG - Intergenic
1194589524 X:95781709-95781731 CTACTAAGTAACTAACAGGTAGG - Intergenic