ID: 1039930446

View in Genome Browser
Species Human (GRCh38)
Location 8:41982638-41982660
Sequence ACCACTAAGTGACTAACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039930446_1039930449 3 Left 1039930446 8:41982638-41982660 CCATTTGTTAGTCACTTAGTGGT 0: 1
1: 0
2: 4
3: 14
4: 185
Right 1039930449 8:41982664-41982686 CTGGGTTATCAGACTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039930446 Original CRISPR ACCACTAAGTGACTAACAAA TGG (reversed) Intronic
908422870 1:63976658-63976680 ATGACCAAGTGACTGACAAAAGG - Intronic
908670518 1:66542530-66542552 ACTACTAAGTGACTAAGAGCAGG + Intronic
908996095 1:70156682-70156704 ACTACTAAGTGACTAAGGATGGG + Intronic
910345149 1:86228102-86228124 ACCTCAGAGTGACTAACACAGGG - Intergenic
910423321 1:87093681-87093703 ACCCGTAAGTGCTTAACAAATGG + Intronic
911151089 1:94597249-94597271 ACCACTTAGAGAATAAAAAAGGG - Intergenic
911504805 1:98735679-98735701 ACCATTAATTGACTTACACAGGG - Intronic
911634325 1:100216987-100217009 AACACTAAGTTTGTAACAAATGG + Intronic
912141145 1:106729320-106729342 ACCACTAAAAAACTTACAAAAGG + Intergenic
918456036 1:184715908-184715930 AACACTAAGTGAAGAACTAAGGG + Intronic
919095037 1:193023542-193023564 ATCACTTAATGACTAACAAATGG - Intronic
919285087 1:195547586-195547608 ATTATTAAGTGATTAACAAATGG + Intergenic
919381032 1:196861556-196861578 ACTACTAAGTGACTAACAGGCGG + Intronic
919575010 1:199297059-199297081 ACCACAAGGTAACAAACAAAAGG + Intergenic
924124205 1:240833210-240833232 ACTACTAAGTGCCTAACAGGTGG + Intronic
1065608619 10:27447590-27447612 ACCAGTAAGAAAGTAACAAATGG - Intergenic
1066757119 10:38722402-38722424 AAAACTAATTGACTCACAAATGG + Intergenic
1069036059 10:63647402-63647424 ACCACTAAATAACTTACTAATGG - Intergenic
1073199997 10:101727577-101727599 GCCACAAAGAGACTTACAAAGGG + Intergenic
1074651007 10:115524519-115524541 ACCACTAAAAGTCTAACACAGGG - Intronic
1078184508 11:9040401-9040423 ACTACTATGTGACTAACATGGGG + Intronic
1078975445 11:16469856-16469878 ACCACTAAGAGATTAAAAATAGG + Intronic
1079061933 11:17256568-17256590 ACTGCTAAGTGACTAATAAATGG + Intronic
1081880648 11:46447930-46447952 AATACTAAGTGTCTAATAAATGG + Intronic
1085310263 11:75512238-75512260 ACCAGTTAGGGACTAAGAAATGG - Intronic
1085977112 11:81670349-81670371 GCTACTAAGTGACTAACAAATGG + Intergenic
1086334600 11:85787390-85787412 ACCATAAAGTTACTAAGAAATGG - Intronic
1088986331 11:114912296-114912318 ACTACTAAGTAACTATCCAATGG + Intergenic
1089975950 11:122731536-122731558 ATAACTAAGTGACTAACAGGCGG + Intronic
1090477850 11:127039761-127039783 GCTGCTAAGTGACTAAGAAATGG + Intergenic
1093333772 12:17875430-17875452 ACCACCAGGTGACTCAAAAATGG + Intergenic
1094296003 12:28905735-28905757 GCTACTAAGTGACTAATAGATGG + Intergenic
1095460322 12:42436718-42436740 GCTACTAAGTGACTAACAGGTGG + Intronic
1096992487 12:55816528-55816550 ACTAATAAGTGACTAAAGAAGGG + Intronic
1097340323 12:58430188-58430210 ACCAATAATAGACAAACAAAGGG + Intergenic
1098336044 12:69405636-69405658 ACTACTAAGTGACTAATAGGCGG + Intergenic
1098543051 12:71681288-71681310 AGCACTATCTTACTAACAAAAGG + Intronic
1099135076 12:78887254-78887276 ACTACTAAGTGACTAACGGGTGG - Intronic
1099357271 12:81653361-81653383 ACCACTAAGATACTAAGACAAGG - Intronic
1100424012 12:94465365-94465387 GCTACTAAGTGACTAACAGGTGG + Intergenic
1102629177 12:114262103-114262125 GCTGCTAAGTGACTAACAGAGGG + Intergenic
1105461943 13:20599781-20599803 AAAACTAAGTGACCAATAAAGGG + Intronic
1106371206 13:29135167-29135189 GCTACTAAGTGACTAATAAGTGG - Intronic
1106710832 13:32330558-32330580 ACTACTAAGTGACTAATAGGTGG + Intronic
1107777927 13:43866030-43866052 ACTACTAAGTGACTAATGAATGG + Intronic
1111418884 13:87984025-87984047 ACAAATTGGTGACTAACAAAGGG + Intergenic
1111623398 13:90752781-90752803 ACTACTAAGTGAAGAAGAAAGGG + Intergenic
1113143932 13:107186103-107186125 GCTACTAAGTGACTAACAGGAGG - Intronic
1115600614 14:34952355-34952377 GCTACTAAGTGACTAACAGGTGG - Intergenic
1115785795 14:36824451-36824473 ACCCCAAACTGACAAACAAATGG + Intronic
1116727794 14:48584181-48584203 ACCACTAAGTGACTAATGAGTGG + Intergenic
1117520694 14:56548619-56548641 AACACTAAGTCAATAACCAAAGG + Intronic
1118043372 14:61940768-61940790 ACCACTATGTGGGTGACAAAAGG - Intergenic
1118099756 14:62583838-62583860 GGCACTAAGTGATTAACAGATGG + Intergenic
1119682398 14:76602677-76602699 AGCACTGAGTGACAAACACAAGG + Intergenic
1120717624 14:87856740-87856762 ATCACTCAGTCACTATCAAATGG - Intronic
1123856905 15:24422077-24422099 ACCAATAAATGACTCAAAAATGG + Intergenic
1126317756 15:47388533-47388555 GCTACTAAGTGACTAACAGGTGG - Intronic
1126385405 15:48088755-48088777 GCTACTAAGTGACTAACGGATGG - Intergenic
1128188601 15:65667630-65667652 ACCACTAAAGGACTAAGATACGG + Exonic
1128439072 15:67686701-67686723 ACCACTCAGTGATTTACCAAAGG + Intronic
1130421735 15:83754842-83754864 ACCTCTAAGTGTATCACAAAAGG + Intronic
1130955903 15:88627112-88627134 AGCACTAAGAAACTAACATAAGG - Intronic
1132351834 15:101144315-101144337 ACTAGTCAGTGACTAACACAGGG + Intergenic
1132954173 16:2582409-2582431 AACACTGAGTAATTAACAAAGGG + Intronic
1132960172 16:2617754-2617776 AACACTGAGTAATTAACAAAGGG - Intergenic
1135042701 16:19130191-19130213 AGCACTAAATAACTAACAGAGGG + Intronic
1138311383 16:56026436-56026458 AACACTAAGTGTCTAAGGAATGG + Intergenic
1140656091 16:77141287-77141309 ACCACTAAATGTCTGGCAAAAGG - Intergenic
1140666323 16:77230916-77230938 ACTACAATGTGACTGACAAATGG - Intergenic
1145882553 17:28363121-28363143 AACTCTATGTGACTAAAAAATGG - Exonic
1147236384 17:39060739-39060761 ACCATTAAGTGACTTGCACAAGG - Intergenic
1154941754 18:21120210-21120232 ACAACTAATTGACAAACATATGG - Intergenic
1155439224 18:25843920-25843942 ACCACAAAGTGCCTTATAAATGG - Intergenic
1159077737 18:63700592-63700614 AATATGAAGTGACTAACAAAAGG - Intronic
1159133000 18:64302340-64302362 ACTACCAAGTGACTGACAGAAGG - Intergenic
1159363941 18:67441630-67441652 GCTGCTAAGTGACTAACTAATGG + Intergenic
1159620904 18:70637207-70637229 GCTACTAAGTGACTAACAGGGGG - Intronic
1160034915 18:75291601-75291623 ACGACTAAGTGACTAAACATGGG + Intergenic
1160134191 18:76258435-76258457 ATCAGGAAGAGACTAACAAATGG - Intergenic
1166526814 19:43515911-43515933 GCTACTAAGTGATTAACGAATGG + Intronic
1167840291 19:52111380-52111402 ACTACTAAGTGACTGAGAGAGGG - Intergenic
924976560 2:180975-180997 ACCATTAAATAACAAACAAATGG - Intergenic
925873462 2:8291654-8291676 ACCATTAAATGCCTAACAACAGG + Intergenic
926646264 2:15292814-15292836 ACGAGCAAGTGAGTAACAAATGG + Intronic
931506363 2:62931761-62931783 ACTACTAAGTGACTAACAGGTGG - Intronic
932757700 2:74420167-74420189 ACCACTATGTGTTCAACAAAAGG + Intronic
933028068 2:77287677-77287699 ACTACTAAGTTACTAACAGGTGG - Intronic
933204606 2:79491246-79491268 ATCACAAAATGACTAAAAAAGGG + Intronic
933800515 2:85956734-85956756 ACCACTCAGTGAATAGGAAATGG - Intergenic
935321005 2:101889336-101889358 ACCACTCACAGACTAACAAGGGG - Intronic
935550656 2:104450061-104450083 ACCACTATGTGATTAAAGAAAGG - Intergenic
939865473 2:147467671-147467693 ACCACTCACTGACTAATAAAGGG + Intergenic
940606516 2:155930533-155930555 ACCAATGATTGACTGACAAAGGG - Intergenic
941248477 2:163131570-163131592 GCCACTAAGTGACTAACAGGTGG - Intergenic
942336670 2:174894981-174895003 GCTACTAAGTGACTAACAGGTGG - Intronic
944447879 2:199809924-199809946 GATACTAAGTGACTAAAAAATGG - Intronic
945498483 2:210538947-210538969 ACCTGTAAGTGACTAGAAAAAGG - Intronic
945760790 2:213911659-213911681 AGGACTTAGTGACAAACAAAAGG + Intronic
948497314 2:238360039-238360061 GCTACTAAGTGACTAACAGGTGG + Intronic
1169200729 20:3708075-3708097 ACCCCTTAGTGACTAAGAGAGGG + Intergenic
1169581925 20:7033333-7033355 ACCACTAAAAGGCTAAGAAATGG - Intergenic
1170906467 20:20519445-20519467 TCCACTAAGGGCCTCACAAAAGG + Intronic
1171820025 20:29827182-29827204 AACATTAAGTGACAACCAAAGGG + Intergenic
1174400398 20:50272882-50272904 ACCACTCAGAGACTGACATATGG + Intergenic
1176931208 21:14812461-14812483 GCAACTAAGTGACTAACAGGTGG + Intergenic
1181276523 22:21690566-21690588 ACCACTAAGGGACTGAGGAATGG - Intronic
1182445942 22:30389661-30389683 CCTACTAAGTGACTAACAGGTGG - Intronic
951544096 3:23807987-23808009 ATCAGTAAGTGACTATAAAATGG + Intronic
956225699 3:66955398-66955420 ACTACAAAATGACTAATAAATGG + Intergenic
956366794 3:68512744-68512766 ACTACTAAGTGACTAAAAGTAGG + Intronic
957824873 3:85428029-85428051 AGCACTAAGAGAATAACAAGAGG - Intronic
957833721 3:85556998-85557020 ACCACAAAGTGACATAAAAATGG - Intronic
957880263 3:86203092-86203114 AACAATAAGTTACAAACAAAAGG + Intergenic
962288890 3:134113471-134113493 GCTACTAAGTGACTAATGAATGG - Intronic
962824409 3:139087535-139087557 ACCACTAAGTAAGTGCCAAAAGG - Intronic
963769947 3:149379255-149379277 ACCACTATGTGTCCAACAACAGG + Intergenic
965959198 3:174408460-174408482 AGCAGTGAGTGACTCACAAATGG + Intergenic
966711051 3:182973204-182973226 GCTACTAAGTGACTAACAGTGGG + Intronic
967571530 3:191034713-191034735 GCCACTAATTGACTAAAAAGTGG + Intergenic
971129397 4:23789685-23789707 ACCATTAGGTGACTTATAAAGGG - Intronic
971957686 4:33443231-33443253 ACCACTATGTGACAAATAACTGG - Intergenic
972296815 4:37746972-37746994 ACCAATAAGTGACACACAAAGGG - Intergenic
974025445 4:56729476-56729498 ACCACTGAGTGAGTTGCAAATGG - Intergenic
975529108 4:75382456-75382478 ACCAATAACTGACAAACAGAGGG + Intergenic
975846394 4:78529711-78529733 GCTACTAAGTGACTAACAAATGG + Intronic
977322872 4:95541326-95541348 ACTACTAAGTGACTACCAGGTGG - Intronic
979011387 4:115374855-115374877 GCTACTAAGTGACTAATAAGAGG - Intergenic
979398850 4:120222616-120222638 ACCACTGAGTGGCTTACACAGGG + Intergenic
981523479 4:145689362-145689384 TCAACTTAGTGACTGACAAAAGG + Intronic
981817289 4:148845360-148845382 ACCTCCTAGTTACTAACAAATGG - Intergenic
984909728 4:184662502-184662524 ACCAGGAAGTTACTAATAAAAGG + Intronic
985181176 4:187265198-187265220 ACCACTAAATATCTAACAGAAGG - Intergenic
987298485 5:16575494-16575516 TCCACTAAGAGAATAACTAATGG - Intronic
987560671 5:19515642-19515664 ACCAGTAACAGACAAACAAAAGG - Intronic
988903222 5:35756217-35756239 GCTACTAAGTGACTAACAGATGG - Intronic
992213879 5:74506898-74506920 ACCAGTCAGTGACTAACAGTTGG + Intergenic
992238376 5:74736342-74736364 AGAACAAAGTTACTAACAAAAGG + Intronic
993468924 5:88282848-88282870 TCTACTAAGTGACTAACAGGTGG + Intergenic
993876823 5:93317176-93317198 CCCACTTGATGACTAACAAAGGG + Intergenic
995170039 5:109097661-109097683 ACCACTAAGTGACAAACTGAAGG - Intronic
995691917 5:114836267-114836289 ACCATTATGAAACTAACAAAAGG - Intergenic
996945496 5:129062240-129062262 ACTGCTAAGTGACTAACAGGTGG + Intergenic
996963468 5:129279730-129279752 CCCACTCAGTGCCTAAGAAAAGG + Intergenic
997514826 5:134480002-134480024 GCTTCTAAGTGACTAACAGATGG + Intergenic
999893721 5:156006375-156006397 ACCAGTTAGTGAATAAAAAAAGG - Intronic
1000894465 5:166838781-166838803 CCTACTAAGTGACTAACAGGTGG - Intergenic
1001981706 5:176042471-176042493 GCTGCTAAGTGACTAACAAGTGG - Intergenic
1002235760 5:177801589-177801611 GCTGCTAAGTGACTAACAAGTGG + Intergenic
1006885042 6:37374517-37374539 ACCACAAAGTCACTAACTAGAGG + Intronic
1010841845 6:80655646-80655668 GCTACTAAGTGACTAACAGGTGG + Intergenic
1011568627 6:88708575-88708597 AGCACTAAGGGACTACCTAAAGG - Intronic
1012770696 6:103430122-103430144 ACCAGAAAATAACTAACAAATGG + Intergenic
1013253126 6:108354631-108354653 GCCACTAAGTGACCAACGAGAGG + Intronic
1013489162 6:110628543-110628565 ACCACTAAGTGACTAACCAGTGG - Intronic
1013959882 6:115887249-115887271 GGCACTAAGTGTCCAACAAAAGG - Intergenic
1014102169 6:117523336-117523358 ACCACCAAATGAGTTACAAAAGG - Intronic
1014669172 6:124278986-124279008 ATCACTAAGTGAGAAACACAAGG + Intronic
1015363483 6:132369683-132369705 GCTACTAAGTGACTAACGGATGG + Intronic
1015406281 6:132840579-132840601 ACCACTAAGTGGTTAAGGAAAGG - Intergenic
1015690444 6:135915951-135915973 ACAACTAAGTGCCTATCAACAGG - Intronic
1016361854 6:143275879-143275901 AACACTAAGTCACTTAAAAATGG + Intronic
1018825280 6:167404190-167404212 AACACTAAGGGACTAAGATAAGG - Intergenic
1018998948 6:168730837-168730859 ACCACTGAGGGACTGACGAAGGG - Intergenic
1019003325 6:168774802-168774824 ACAAATATGTGAATAACAAATGG - Intergenic
1021308002 7:19054846-19054868 ACCACTTAGTGAATTAGAAAAGG + Intronic
1021503717 7:21357581-21357603 ATCACTAAGCTACTAACAATTGG - Intergenic
1022193127 7:28036720-28036742 ACCTCTAGGTGTCTAATAAAGGG - Intronic
1023164584 7:37330938-37330960 GCTACTAAGTGACTAACAAATGG + Intronic
1023302216 7:38784864-38784886 ACCAATAAGGGAATAAGAAATGG - Intronic
1023678790 7:42661453-42661475 GCAGCTAAGTGACTAACAAGTGG + Intergenic
1030919699 7:115366930-115366952 ACTACTCAGTGACTAACAGATGG + Intergenic
1031230410 7:119098477-119098499 AAAACAAAGTGACTAAAAAATGG - Intergenic
1031416375 7:121501282-121501304 ACAACTAAGCGACTAATACATGG - Intergenic
1036134867 8:6151635-6151657 ACCACTTAGAGTCTAACCAAGGG + Intergenic
1037266697 8:17070894-17070916 ACTACTAAGTGCCTAACAGGTGG + Intronic
1037859584 8:22395343-22395365 AAGACAAAGAGACTAACAAAAGG - Intronic
1039930446 8:41982638-41982660 ACCACTAAGTGACTAACAAATGG - Intronic
1040761688 8:50853098-50853120 ATCACCAAGTGACTAACCTAAGG - Intergenic
1041067700 8:54098273-54098295 GCTACCAAGTGACTAACAGATGG + Intronic
1042231708 8:66561886-66561908 ACCACTAAGTGACAGAACAAAGG + Intergenic
1043711349 8:83422651-83422673 TTCACTGAGTGAATAACAAAGGG + Intergenic
1043989610 8:86736638-86736660 ACCAAAATGTGATTAACAAATGG - Intronic
1044373694 8:91444928-91444950 CACACTGAGTGAGTAACAAAAGG + Intergenic
1044389701 8:91635269-91635291 ACCACTAATAGACTAAAAATAGG + Intergenic
1045895111 8:107206683-107206705 ACTACTAAGTAACTATCAGATGG + Intergenic
1047068256 8:121312058-121312080 ACCAGAAATTAACTAACAAATGG - Intergenic
1049140929 8:140953457-140953479 GCTACTAAGTGACTAACAGGCGG + Intronic
1055219693 9:73913728-73913750 ACCACTCATTTAGTAACAAAAGG - Intergenic
1056255641 9:84796244-84796266 ACCACTAGGTCACAAACAAGAGG - Intronic
1203371687 Un_KI270442v1:312448-312470 AACATTAAGTGACAAACAAAGGG + Intergenic
1186009634 X:5115196-5115218 ACCAATGAGTGAGTTACAAATGG - Intergenic
1188933064 X:36138997-36139019 GCCCCTAAGTAACAAACAAAAGG - Intronic
1189129513 X:38483869-38483891 ACCAAGAAATGAATAACAAATGG + Intronic
1189234094 X:39474534-39474556 AGCACTTAGTGACTGACACATGG + Intergenic
1190149252 X:47929440-47929462 GCTACTAAGTGACTAACAAGTGG + Intronic
1193010896 X:76674094-76674116 ACCAATAATAGACAAACAAAGGG + Intergenic
1194342288 X:92719862-92719884 ACCAATAACAGACAAACAAAGGG + Intergenic
1194998405 X:100617042-100617064 ACCACTAAGAAAATAACACAAGG + Intergenic
1195811658 X:108839678-108839700 ACCACTAAGTGACTAATGGGCGG - Intergenic
1196907739 X:120454187-120454209 GCTACTAAGTGACTAACGGATGG - Intronic
1198790360 X:140339066-140339088 ACCACTAAGTGAAAAGCACATGG - Intergenic
1200650645 Y:5836553-5836575 ACCAATAACAGACAAACAAAGGG + Intergenic
1202051607 Y:20787101-20787123 ACAACTAACTCAATAACAAATGG - Intergenic