ID: 1039930449

View in Genome Browser
Species Human (GRCh38)
Location 8:41982664-41982686
Sequence CTGGGTTATCAGACTGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039930446_1039930449 3 Left 1039930446 8:41982638-41982660 CCATTTGTTAGTCACTTAGTGGT 0: 1
1: 0
2: 4
3: 14
4: 185
Right 1039930449 8:41982664-41982686 CTGGGTTATCAGACTGTTGCTGG No data
1039930442_1039930449 22 Left 1039930442 8:41982619-41982641 CCCACACTGCATACACTACCCAT 0: 1
1: 0
2: 2
3: 15
4: 146
Right 1039930449 8:41982664-41982686 CTGGGTTATCAGACTGTTGCTGG No data
1039930443_1039930449 21 Left 1039930443 8:41982620-41982642 CCACACTGCATACACTACCCATT 0: 1
1: 0
2: 4
3: 26
4: 205
Right 1039930449 8:41982664-41982686 CTGGGTTATCAGACTGTTGCTGG No data
1039930444_1039930449 4 Left 1039930444 8:41982637-41982659 CCCATTTGTTAGTCACTTAGTGG 0: 1
1: 3
2: 3
3: 42
4: 231
Right 1039930449 8:41982664-41982686 CTGGGTTATCAGACTGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039930449 Original CRISPR CTGGGTTATCAGACTGTTGC TGG Intronic
No off target data available for this crispr