ID: 1039932422

View in Genome Browser
Species Human (GRCh38)
Location 8:42005924-42005946
Sequence TTTCAGTTCTTGGGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039932414_1039932422 26 Left 1039932414 8:42005875-42005897 CCATAATTAAAGTCTTGATCCAG 0: 1
1: 0
2: 2
3: 12
4: 183
Right 1039932422 8:42005924-42005946 TTTCAGTTCTTGGGGGAAGAAGG No data
1039932415_1039932422 7 Left 1039932415 8:42005894-42005916 CCAGAAGCAATGACTCCCTTCTG 0: 1
1: 0
2: 1
3: 24
4: 237
Right 1039932422 8:42005924-42005946 TTTCAGTTCTTGGGGGAAGAAGG No data
1039932416_1039932422 -8 Left 1039932416 8:42005909-42005931 CCCTTCTGAAAATGATTTCAGTT 0: 1
1: 0
2: 2
3: 60
4: 479
Right 1039932422 8:42005924-42005946 TTTCAGTTCTTGGGGGAAGAAGG No data
1039932417_1039932422 -9 Left 1039932417 8:42005910-42005932 CCTTCTGAAAATGATTTCAGTTC 0: 1
1: 0
2: 0
3: 37
4: 354
Right 1039932422 8:42005924-42005946 TTTCAGTTCTTGGGGGAAGAAGG No data
1039932413_1039932422 27 Left 1039932413 8:42005874-42005896 CCCATAATTAAAGTCTTGATCCA 0: 1
1: 0
2: 1
3: 13
4: 189
Right 1039932422 8:42005924-42005946 TTTCAGTTCTTGGGGGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039932422 Original CRISPR TTTCAGTTCTTGGGGGAAGA AGG Intronic
No off target data available for this crispr