ID: 1039933343

View in Genome Browser
Species Human (GRCh38)
Location 8:42015560-42015582
Sequence AATTTATACGACTGTATAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039933343_1039933345 6 Left 1039933343 8:42015560-42015582 CCTCCTATACAGTCGTATAAATT 0: 1
1: 0
2: 0
3: 7
4: 86
Right 1039933345 8:42015589-42015611 TATAGATAAATTTCAACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039933343 Original CRISPR AATTTATACGACTGTATAGG AGG (reversed) Intronic
900967365 1:5968129-5968151 AATTTATTCATCTGTATATGAGG - Intronic
910315764 1:85881958-85881980 AATTTATAGCACTGAATAAGAGG - Intronic
917009963 1:170459880-170459902 AAATTTTATGGCTGTATAGGTGG - Intergenic
918471047 1:184873883-184873905 CATTTTTACCACTGTAGAGGAGG - Intronic
1065773743 10:29100994-29101016 TATTTATATGACTGTATATGAGG - Intergenic
1070691052 10:78526007-78526029 AATTTATGCTAATGTATAGTAGG - Intergenic
1073571938 10:104588277-104588299 AATTTTTAAGAGTGTAAAGGGGG + Intergenic
1073598629 10:104824492-104824514 AATTTGTAGGATTGAATAGGAGG + Intronic
1074239680 10:111625181-111625203 AATTTATACCACTTTACATGTGG + Intergenic
1086355601 11:85995240-85995262 AATTTATAGGACTTAATATGGGG + Intronic
1086903734 11:92395951-92395973 AATTTATACTGCTGTACAAGTGG - Intronic
1088866586 11:113853500-113853522 AATATCTACGAGAGTATAGGAGG - Intronic
1092970957 12:13694256-13694278 GATTTATACAACTGTATATTTGG + Intronic
1093133886 12:15425553-15425575 AAATTATAAGAATGTCTAGGAGG - Intronic
1093526817 12:20113286-20113308 ACATTATAGGAATGTATAGGTGG - Intergenic
1095440098 12:42229842-42229864 ATTTTATGGGACTGTATATGTGG + Intronic
1097813715 12:64047842-64047864 AATTTTTATGACTATATAGTAGG + Intronic
1099378517 12:81924844-81924866 AATATATAAGTCTGTATTGGTGG + Intergenic
1111158455 13:84359988-84360010 AATTTATACCACTGTACATCAGG - Intergenic
1112779713 13:102886133-102886155 ACTGTATATGACTGTATATGTGG + Intergenic
1113107012 13:106783133-106783155 AATTTAGACGAATGTATAACTGG - Intergenic
1115136255 14:30111938-30111960 AATTTATACTAATGTATACTGGG - Intronic
1120354074 14:83406640-83406662 AATTTATGTGACAGTTTAGGGGG - Intergenic
1120536951 14:85708312-85708334 ATTTTATACTACTGTATTTGAGG - Intergenic
1123828768 15:24111293-24111315 AATTTAAACAACTGTAAAAGTGG - Intergenic
1124952155 15:34333645-34333667 AATTTATAGGACTGTCCAGTTGG - Intronic
1131854985 15:96584064-96584086 AATTTAAACGAGTGTATAGAGGG + Intergenic
1153901213 18:9618510-9618532 AATGTATAGAAATGTATAGGAGG - Intergenic
1157184385 18:45525800-45525822 AATTTGTACAACTGTAAATGGGG - Intronic
925424785 2:3739816-3739838 AGTTTAGCCGTCTGTATAGGTGG - Intronic
928023421 2:27721355-27721377 TATTTATTCTACTGTAAAGGAGG + Intergenic
931039387 2:58280202-58280224 AATTAATACAACTGTATAAGTGG + Intergenic
937665960 2:124486867-124486889 AGTTTAGAACACTGTATAGGTGG + Intronic
938927023 2:136052927-136052949 AATTTACACCTCTGTAAAGGAGG - Intergenic
939468944 2:142594712-142594734 AATTTGTATAACTGTATAGAAGG + Intergenic
941167686 2:162100910-162100932 GATTTATATGACTGTATCAGTGG + Intergenic
941602446 2:167559561-167559583 AATTTAGACGAATGTATAGCTGG + Intergenic
943292246 2:186088746-186088768 AAATGATACAACTGTATAGAGGG + Intergenic
944886433 2:204067243-204067265 AAATTATATGACTGTAGAGTTGG + Intergenic
945080046 2:206079392-206079414 AATGTATACAACTGCATATGTGG + Intronic
1170619615 20:17984477-17984499 TTTTTATATGACTGAATAGGAGG - Intronic
1180916374 22:19491190-19491212 AAATTATAACACTGTATATGTGG - Intronic
949621258 3:5814079-5814101 AAATTATTGGACTGTATAGCTGG + Intergenic
951071085 3:18330168-18330190 AATTTAGACGAATGTATAACTGG - Intronic
956159646 3:66335768-66335790 AATTTATACTGCTGTATGGTCGG - Intronic
956299002 3:67748721-67748743 AGTTTATACAAATGTATAGGTGG + Intergenic
957308434 3:78488282-78488304 AATTTAGACGAATGTATAACTGG + Intergenic
959663152 3:108891824-108891846 AATCTATCTGACTGTATAAGTGG - Intergenic
960476075 3:118130271-118130293 AATTTGTACGTCTGTATAAGGGG + Intergenic
965389400 3:168086040-168086062 AATTTTTTTTACTGTATAGGCGG - Intronic
967756524 3:193176420-193176442 AATTTATAGGACTTCACAGGTGG - Intergenic
971521231 4:27553150-27553172 AATTAATACCAATGTATAGTTGG + Intergenic
972170710 4:36342322-36342344 AATTTACAGGAGTGTGTAGGAGG + Intronic
974901759 4:68008264-68008286 AAGTTTTAGAACTGTATAGGGGG - Intergenic
982052191 4:151512558-151512580 AATTTAGACGACTGTATAACTGG + Intronic
982148699 4:152427677-152427699 AATTTTTAAGAGTGTAAAGGAGG - Intronic
985282628 4:188302077-188302099 AATTTAGAAGACAGTGTAGGAGG + Intergenic
987308855 5:16663836-16663858 ATATTATACCACTGTATAGCAGG + Intronic
988320247 5:29685620-29685642 AATTTTTATGGCTGCATAGGTGG + Intergenic
990645090 5:57834848-57834870 GATTTCTACGACAGTAGAGGTGG + Intergenic
993271333 5:85801147-85801169 AATGTCTACCACTGTTTAGGAGG - Intergenic
995985809 5:118172138-118172160 AATTTATAAGACTGTCTTTGGGG + Intergenic
999975504 5:156908239-156908261 AAATAATACGACTGTGTTGGTGG + Intergenic
1000575561 5:162970928-162970950 AAGTTATACTACAGTAGAGGTGG - Intergenic
1000774017 5:165394459-165394481 AAATTATACGGCTAGATAGGAGG + Intergenic
1003830090 6:9999537-9999559 AATTTATATGTCTGTCTTGGAGG + Intronic
1005380381 6:25228167-25228189 AATTTATATTACTATAAAGGTGG + Intergenic
1008808264 6:55458260-55458282 ATTTTCTACTACTGTATACGTGG - Intronic
1009304166 6:62066063-62066085 TATTTATACAACTGTATTAGGGG + Intronic
1012604069 6:101134883-101134905 AAATTATAGGACTCTATAGTAGG - Intergenic
1012726620 6:102820869-102820891 AATTTAGACGAATGTATAACTGG + Intergenic
1014798912 6:125756147-125756169 AAATTTTAGGACTGTCTAGGTGG - Intronic
1031105298 7:117534407-117534429 AAATTATACAACTGGAAAGGCGG + Intronic
1033844677 7:145417843-145417865 AATTTAGACGAATGTATAACTGG - Intergenic
1034171093 7:149063926-149063948 ACATTATATGACTGTATAGTAGG - Intergenic
1036166182 8:6435836-6435858 AATTTAAAAGACTGTATAAAAGG - Intronic
1037029492 8:14085849-14085871 AATTTATTCAAATGAATAGGGGG - Intergenic
1039933343 8:42015560-42015582 AATTTATACGACTGTATAGGAGG - Intronic
1041820629 8:62028507-62028529 AATTGATACAGCTGTAAAGGAGG - Intergenic
1043303453 8:78763407-78763429 ACATTATACCACTTTATAGGAGG - Intronic
1043835204 8:85037419-85037441 AATTTATAATACTTTTTAGGAGG + Intergenic
1044101524 8:88146911-88146933 AATTTATACTCCTATATAGCAGG + Intronic
1046208983 8:111041620-111041642 AATTTATACTCCTGGAAAGGGGG + Intergenic
1046210881 8:111074001-111074023 AATTTATACCAGTGAAAAGGAGG - Intergenic
1050063552 9:1735225-1735247 AATCTATATAAATGTATAGGGGG - Intergenic
1052170727 9:25392850-25392872 TATTTATACTATTGTAGAGGAGG - Intergenic
1055371995 9:75610253-75610275 AATTTTTAAGACTATAAAGGGGG + Intergenic
1056290611 9:85140091-85140113 AGTTTCTTTGACTGTATAGGAGG + Intergenic
1058829946 9:108807406-108807428 AATTTACTGGACTGTATATGGGG - Intergenic
1059141206 9:111855088-111855110 AAATTCTAGGACTGTTTAGGAGG - Intergenic
1060777140 9:126383201-126383223 ATTTTTTACAACTGTAAAGGAGG + Intronic
1190587740 X:51964253-51964275 AATTTAGACGAATGTATAACTGG - Intergenic
1191176236 X:57504717-57504739 AATTTAAAGGAGTGTATAGAGGG + Intergenic
1191194877 X:57709770-57709792 AATTTAGACGAATGTATAACTGG + Intergenic