ID: 1039934420

View in Genome Browser
Species Human (GRCh38)
Location 8:42028979-42029001
Sequence GGGAATTTATCAACACTAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039934420_1039934422 -3 Left 1039934420 8:42028979-42029001 CCATCTAGTGTTGATAAATTCCC No data
Right 1039934422 8:42028999-42029021 CCCTTGATTTTTTTCTTATCTGG No data
1039934420_1039934424 -2 Left 1039934420 8:42028979-42029001 CCATCTAGTGTTGATAAATTCCC No data
Right 1039934424 8:42029000-42029022 CCTTGATTTTTTTCTTATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039934420 Original CRISPR GGGAATTTATCAACACTAGA TGG (reversed) Intronic