ID: 1039936491

View in Genome Browser
Species Human (GRCh38)
Location 8:42051362-42051384
Sequence CGGATCCCCGCGCCCCCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1039936481_1039936491 2 Left 1039936481 8:42051337-42051359 CCCCGCTCGCCGCCTCAGCCCCG No data
Right 1039936491 8:42051362-42051384 CGGATCCCCGCGCCCCCGGCCGG No data
1039936483_1039936491 0 Left 1039936483 8:42051339-42051361 CCGCTCGCCGCCTCAGCCCCGCT No data
Right 1039936491 8:42051362-42051384 CGGATCCCCGCGCCCCCGGCCGG No data
1039936476_1039936491 26 Left 1039936476 8:42051313-42051335 CCACAACACCCGCCGGCCTGTCA No data
Right 1039936491 8:42051362-42051384 CGGATCCCCGCGCCCCCGGCCGG No data
1039936485_1039936491 -7 Left 1039936485 8:42051346-42051368 CCGCCTCAGCCCCGCTCGGATCC No data
Right 1039936491 8:42051362-42051384 CGGATCCCCGCGCCCCCGGCCGG No data
1039936479_1039936491 14 Left 1039936479 8:42051325-42051347 CCGGCCTGTCAGCCCCGCTCGCC No data
Right 1039936491 8:42051362-42051384 CGGATCCCCGCGCCCCCGGCCGG No data
1039936478_1039936491 17 Left 1039936478 8:42051322-42051344 CCGCCGGCCTGTCAGCCCCGCTC No data
Right 1039936491 8:42051362-42051384 CGGATCCCCGCGCCCCCGGCCGG No data
1039936482_1039936491 1 Left 1039936482 8:42051338-42051360 CCCGCTCGCCGCCTCAGCCCCGC No data
Right 1039936491 8:42051362-42051384 CGGATCCCCGCGCCCCCGGCCGG No data
1039936486_1039936491 -10 Left 1039936486 8:42051349-42051371 CCTCAGCCCCGCTCGGATCCCCG No data
Right 1039936491 8:42051362-42051384 CGGATCCCCGCGCCCCCGGCCGG No data
1039936480_1039936491 10 Left 1039936480 8:42051329-42051351 CCTGTCAGCCCCGCTCGCCGCCT No data
Right 1039936491 8:42051362-42051384 CGGATCCCCGCGCCCCCGGCCGG No data
1039936477_1039936491 18 Left 1039936477 8:42051321-42051343 CCCGCCGGCCTGTCAGCCCCGCT No data
Right 1039936491 8:42051362-42051384 CGGATCCCCGCGCCCCCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1039936491 Original CRISPR CGGATCCCCGCGCCCCCGGC CGG Intronic